Incidental Mutation 'R4437:Gm2381'
ID329576
Institutional Source Beutler Lab
Gene Symbol Gm2381
Ensembl Gene ENSMUSG00000092225
Gene Namepredicted gene 2381
Synonyms
MMRRC Submission 041150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4437 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42816829-42867234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42819844 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 285 (H285Q)
Ref Sequence ENSEMBL: ENSMUSP00000133949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174558]
Predicted Effect probably damaging
Transcript: ENSMUST00000174558
AA Change: H285Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133949
Gene: ENSMUSG00000092225
AA Change: H285Q

DomainStartEndE-ValueType
Blast:KRAB 1 34 1e-15 BLAST
ZnF_C2H2 99 121 5.5e-3 SMART
ZnF_C2H2 127 149 5.9e-3 SMART
ZnF_C2H2 155 177 7.37e-4 SMART
ZnF_C2H2 183 205 2.75e-3 SMART
ZnF_C2H2 211 233 3.69e-4 SMART
ZnF_C2H2 239 261 3.34e-2 SMART
ZnF_C2H2 267 289 1.58e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Arhgef16 A G 4: 154,279,696 probably null Het
AW549877 T C 15: 3,991,836 E79G probably damaging Het
Bcar1 G A 8: 111,715,389 T273M probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bptf A G 11: 107,074,474 V1235A possibly damaging Het
Camsap1 G A 2: 25,938,646 T1022I possibly damaging Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Col4a1 G T 8: 11,206,387 C1493* probably null Het
Cul9 A G 17: 46,502,159 L2378P probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam71d T A 12: 78,715,050 F163I probably damaging Het
Frem3 A G 8: 80,612,607 I510V probably benign Het
Gm4884 A G 7: 41,043,090 Q161R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv1-99 T G 6: 68,542,334 S91A probably benign Het
Itga6 T C 2: 71,825,638 L302P probably benign Het
Mdga2 T C 12: 66,473,198 probably null Het
Myoc A G 1: 162,649,112 M462V possibly damaging Het
Nkx2-4 T C 2: 147,084,259 T228A possibly damaging Het
Npr1 T G 3: 90,456,286 D810A probably damaging Het
Olfr1240 T G 2: 89,439,354 R308S possibly damaging Het
Olfr645 T C 7: 104,084,921 E53G possibly damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pde4dip G A 3: 97,766,569 L344F possibly damaging Het
Pfas A G 11: 68,988,417 L1218P probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Vps33a A T 5: 123,531,884 I519N probably benign Het
Other mutations in Gm2381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Gm2381 APN 7 42822609 splice site probably benign
R0266:Gm2381 UTSW 7 42819948 nonsense probably null
R0617:Gm2381 UTSW 7 42819978 missense probably damaging 1.00
R0650:Gm2381 UTSW 7 42820080 missense probably damaging 0.98
R0849:Gm2381 UTSW 7 42819948 nonsense probably null
R1340:Gm2381 UTSW 7 42820404 missense possibly damaging 0.76
R1549:Gm2381 UTSW 7 42822401 missense probably benign 0.09
R1702:Gm2381 UTSW 7 42820231 missense probably benign 0.08
R1708:Gm2381 UTSW 7 42820225 missense probably benign 0.05
R1909:Gm2381 UTSW 7 42819928 missense probably damaging 1.00
R2848:Gm2381 UTSW 7 42820407 missense probably damaging 0.98
R2849:Gm2381 UTSW 7 42820407 missense probably damaging 0.98
R5445:Gm2381 UTSW 7 42820001 missense probably damaging 0.96
R5702:Gm2381 UTSW 7 42822396 missense probably benign 0.12
R6370:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6371:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6372:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6688:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R7150:Gm2381 UTSW 7 42820464 missense probably benign 0.04
R7336:Gm2381 UTSW 7 42822380 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGGCTTTACCACATTGATTACATTC -3'
(R):5'- GTAATAAAGCCTATCCACGCCG -3'

Sequencing Primer
(F):5'- GCTGGGATGTAAAAAGGCTTTTTCAC -3'
(R):5'- GCCTTTTCACAACAGAGTAATCTCCG -3'
Posted On2015-07-21