Incidental Mutation 'R4437:Pfas'
ID329583
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
MMRRC Submission 041150-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4437 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68988417 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1218 (L1218P)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: L1218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: L1218P

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146490
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152964
AA Change: L322P
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: L322P

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174986
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Arhgef16 A G 4: 154,279,696 probably null Het
AW549877 T C 15: 3,991,836 E79G probably damaging Het
Bcar1 G A 8: 111,715,389 T273M probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bptf A G 11: 107,074,474 V1235A possibly damaging Het
Camsap1 G A 2: 25,938,646 T1022I possibly damaging Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Col4a1 G T 8: 11,206,387 C1493* probably null Het
Cul9 A G 17: 46,502,159 L2378P probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam71d T A 12: 78,715,050 F163I probably damaging Het
Frem3 A G 8: 80,612,607 I510V probably benign Het
Gm2381 A T 7: 42,819,844 H285Q probably damaging Het
Gm4884 A G 7: 41,043,090 Q161R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv1-99 T G 6: 68,542,334 S91A probably benign Het
Itga6 T C 2: 71,825,638 L302P probably benign Het
Mdga2 T C 12: 66,473,198 probably null Het
Myoc A G 1: 162,649,112 M462V possibly damaging Het
Nkx2-4 T C 2: 147,084,259 T228A possibly damaging Het
Npr1 T G 3: 90,456,286 D810A probably damaging Het
Olfr1240 T G 2: 89,439,354 R308S possibly damaging Het
Olfr645 T C 7: 104,084,921 E53G possibly damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pde4dip G A 3: 97,766,569 L344F possibly damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Vps33a A T 5: 123,531,884 I519N probably benign Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
Predicted Primers PCR Primer
(F):5'- TCAGAGGGTACTGCTCTGTG -3'
(R):5'- TAATGGCTGTCAGCTGCTG -3'

Sequencing Primer
(F):5'- GGGGTTCCCATCATCGTCTG -3'
(R):5'- CTGCTGGCTCTTCTGGGC -3'
Posted On2015-07-21