Incidental Mutation 'R4437:Mdga2'
ID329585
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 041150-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4437 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 66473198 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000113942] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
Predicted Effect probably null
Transcript: ENSMUST00000037181
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113942
SMART Domains Protein: ENSMUSP00000109575
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
transmembrane domain 60 91 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178814
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222167
Predicted Effect probably null
Transcript: ENSMUST00000222623
Predicted Effect probably null
Transcript: ENSMUST00000222987
Predicted Effect probably null
Transcript: ENSMUST00000223141
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Arhgef16 A G 4: 154,279,696 probably null Het
AW549877 T C 15: 3,991,836 E79G probably damaging Het
Bcar1 G A 8: 111,715,389 T273M probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bptf A G 11: 107,074,474 V1235A possibly damaging Het
Camsap1 G A 2: 25,938,646 T1022I possibly damaging Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Col4a1 G T 8: 11,206,387 C1493* probably null Het
Cul9 A G 17: 46,502,159 L2378P probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam71d T A 12: 78,715,050 F163I probably damaging Het
Frem3 A G 8: 80,612,607 I510V probably benign Het
Gm2381 A T 7: 42,819,844 H285Q probably damaging Het
Gm4884 A G 7: 41,043,090 Q161R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv1-99 T G 6: 68,542,334 S91A probably benign Het
Itga6 T C 2: 71,825,638 L302P probably benign Het
Myoc A G 1: 162,649,112 M462V possibly damaging Het
Nkx2-4 T C 2: 147,084,259 T228A possibly damaging Het
Npr1 T G 3: 90,456,286 D810A probably damaging Het
Olfr1240 T G 2: 89,439,354 R308S possibly damaging Het
Olfr645 T C 7: 104,084,921 E53G possibly damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pde4dip G A 3: 97,766,569 L344F possibly damaging Het
Pfas A G 11: 68,988,417 L1218P probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Vps33a A T 5: 123,531,884 I519N probably benign Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
R8715:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66568953 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AATATGGCCACATTGCACTAGC -3'
(R):5'- TGGGCTTTAACAGATATGCAAACC -3'

Sequencing Primer
(F):5'- GCTTTTTGACTTAAGCATACCTTGG -3'
(R):5'- TGAAGAGTCATGCTATATGCTTAGAG -3'
Posted On2015-07-21