Incidental Mutation 'R4437:Rln1'
ID329598
Institutional Source Beutler Lab
Gene Symbol Rln1
Ensembl Gene ENSMUSG00000039097
Gene Namerelaxin 1
Synonymsrlx
MMRRC Submission 041150-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4437 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29331170-29334670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29334562 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 12 (F12Y)
Ref Sequence ENSEMBL: ENSMUSP00000043376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044143
AA Change: F12Y

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043376
Gene: ENSMUSG00000039097
AA Change: F12Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IlGF 33 185 6.34e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182039
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]
PHENOTYPE: Inactivation of this locus is compatible with fertility but not normal mammary gland development. Postpartum, homozygous mutant females exhibit slight nipples that are insufficient for suckling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Arhgef16 A G 4: 154,279,696 probably null Het
AW549877 T C 15: 3,991,836 E79G probably damaging Het
Bcar1 G A 8: 111,715,389 T273M probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bptf A G 11: 107,074,474 V1235A possibly damaging Het
Camsap1 G A 2: 25,938,646 T1022I possibly damaging Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Col4a1 G T 8: 11,206,387 C1493* probably null Het
Cul9 A G 17: 46,502,159 L2378P probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam71d T A 12: 78,715,050 F163I probably damaging Het
Frem3 A G 8: 80,612,607 I510V probably benign Het
Gm2381 A T 7: 42,819,844 H285Q probably damaging Het
Gm4884 A G 7: 41,043,090 Q161R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv1-99 T G 6: 68,542,334 S91A probably benign Het
Itga6 T C 2: 71,825,638 L302P probably benign Het
Mdga2 T C 12: 66,473,198 probably null Het
Myoc A G 1: 162,649,112 M462V possibly damaging Het
Nkx2-4 T C 2: 147,084,259 T228A possibly damaging Het
Npr1 T G 3: 90,456,286 D810A probably damaging Het
Olfr1240 T G 2: 89,439,354 R308S possibly damaging Het
Olfr645 T C 7: 104,084,921 E53G possibly damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pde4dip G A 3: 97,766,569 L344F possibly damaging Het
Pfas A G 11: 68,988,417 L1218P probably damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Tsc2 G A 17: 24,599,713 P1450L probably benign Het
Vps33a A T 5: 123,531,884 I519N probably benign Het
Other mutations in Rln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Rln1 APN 19 29332014 missense possibly damaging 0.84
IGL01607:Rln1 APN 19 29331860 missense probably benign 0.02
IGL02415:Rln1 APN 19 29334398 missense probably damaging 0.97
R0184:Rln1 UTSW 19 29331936 nonsense probably null
R1670:Rln1 UTSW 19 29332068 missense possibly damaging 0.95
R1965:Rln1 UTSW 19 29334595 start codon destroyed probably null 0.53
R4434:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R4438:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R5525:Rln1 UTSW 19 29334520 missense probably benign 0.44
R6484:Rln1 UTSW 19 29334502 missense probably benign
R6648:Rln1 UTSW 19 29332121 missense probably benign 0.28
R7624:Rln1 UTSW 19 29332099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGCCAATGGGAAGCATG -3'
(R):5'- AGACAATACCACGCAGGCTG -3'

Sequencing Primer
(F):5'- TGAGAAGGCGCTCACCAGTG -3'
(R):5'- CACGCAGGCTGAGGGTG -3'
Posted On2015-07-21