Incidental Mutation 'R4438:Dpy19l3'
ID329626
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
MMRRC Submission 041703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4438 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35692859 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 636 (I636T)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000143590]
Predicted Effect probably damaging
Transcript: ENSMUST00000051377
AA Change: I636T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: I636T

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143590
Meta Mutation Damage Score 0.8714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T A 2: 58,477,727 I141F probably benign Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adck1 C T 12: 88,431,150 Q185* probably null Het
Adgrb3 T C 1: 25,831,027 probably benign Het
Als2cl T C 9: 110,885,398 S105P probably damaging Het
Asns C A 6: 7,675,320 A561S probably benign Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bst1 A T 5: 43,825,340 probably null Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Csnk1e A T 15: 79,420,929 S323T probably benign Het
Cyp2j7 G T 4: 96,217,409 T288K probably benign Het
Dnaaf5 T A 5: 139,163,392 I482N probably damaging Het
Enpep T G 3: 129,284,091 T626P possibly damaging Het
Fgfr2 G A 7: 130,172,930 R509* probably null Het
Gm14409 T G 2: 177,265,096 Q203P possibly damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpr83 T C 9: 14,864,838 Y152H probably damaging Het
Hdac7 T C 15: 97,807,715 E400G probably damaging Het
Hypk A T 2: 121,457,994 E82V probably damaging Het
Iqub C A 6: 24,505,868 A14S probably benign Het
Lias T C 5: 65,395,444 M130T probably damaging Het
Lingo4 T C 3: 94,402,897 S381P possibly damaging Het
Mdn1 A G 4: 32,704,635 T1536A probably damaging Het
Moxd2 T A 6: 40,884,062 D265V probably damaging Het
Mtbp C A 15: 55,603,215 S541R probably benign Het
Olfr1408 C A 1: 173,130,302 C305F probably benign Het
Olfr441 T C 6: 43,116,287 S182P probably benign Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pcsk9 G T 4: 106,458,959 Q96K probably benign Het
Pramef17 T C 4: 143,991,622 Y417C probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Setd1a A G 7: 127,785,731 N585D possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Smarcal1 T C 1: 72,611,478 probably benign Het
Snx19 G T 9: 30,428,599 L344F probably benign Het
Srfbp1 T C 18: 52,488,331 C155R probably benign Het
Sspo C T 6: 48,487,353 R3914C probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tmub1 A C 5: 24,446,070 L197R probably damaging Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Tnfrsf21 G T 17: 43,087,842 R613L possibly damaging Het
Ugt3a2 A T 15: 9,351,197 E97D probably benign Het
Vmn2r25 A G 6: 123,839,797 I275T probably benign Het
Zfp568 G T 7: 30,022,296 C221F probably benign Het
Zfp91 C A 19: 12,778,021 E217* probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35695316 missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35708042 intron probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35708630 missense probably benign
R7198:Dpy19l3 UTSW 7 35749765 missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R8034:Dpy19l3 UTSW 7 35749856 missense probably benign
R8073:Dpy19l3 UTSW 7 35729748 missense probably damaging 1.00
R8183:Dpy19l3 UTSW 7 35695389 missense probably damaging 0.96
R8206:Dpy19l3 UTSW 7 35729730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGACCTCTACAAATGTCTG -3'
(R):5'- CAAGTCCTTTTGGCATCTAAGC -3'

Sequencing Primer
(F):5'- CAGGACCTCTACAAATGTCTGACTTG -3'
(R):5'- CCTTTTGGCATCTAAGCTAGATATG -3'
Posted On2015-07-21