Incidental Mutation 'R4438:Ugt3a2'
ID329639
Institutional Source Beutler Lab
Gene Symbol Ugt3a2
Ensembl Gene ENSMUSG00000049152
Gene NameUDP glycosyltransferases 3 family, polypeptide A2
Synonyms
MMRRC Submission 041703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4438 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9335550-9370955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9351197 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 97 (E97D)
Ref Sequence ENSEMBL: ENSMUSP00000072236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072403]
Predicted Effect probably benign
Transcript: ENSMUST00000072403
AA Change: E97D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000072236
Gene: ENSMUSG00000049152
AA Change: E97D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.1e-99 PFAM
Pfam:Glyco_tran_28_C 307 450 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144755
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T A 2: 58,477,727 I141F probably benign Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adck1 C T 12: 88,431,150 Q185* probably null Het
Adgrb3 T C 1: 25,831,027 probably benign Het
Als2cl T C 9: 110,885,398 S105P probably damaging Het
Asns C A 6: 7,675,320 A561S probably benign Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bst1 A T 5: 43,825,340 probably null Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Csnk1e A T 15: 79,420,929 S323T probably benign Het
Cyp2j7 G T 4: 96,217,409 T288K probably benign Het
Dnaaf5 T A 5: 139,163,392 I482N probably damaging Het
Dpy19l3 A G 7: 35,692,859 I636T probably damaging Het
Enpep T G 3: 129,284,091 T626P possibly damaging Het
Fgfr2 G A 7: 130,172,930 R509* probably null Het
Gm14409 T G 2: 177,265,096 Q203P possibly damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpr83 T C 9: 14,864,838 Y152H probably damaging Het
Hdac7 T C 15: 97,807,715 E400G probably damaging Het
Hypk A T 2: 121,457,994 E82V probably damaging Het
Iqub C A 6: 24,505,868 A14S probably benign Het
Lias T C 5: 65,395,444 M130T probably damaging Het
Lingo4 T C 3: 94,402,897 S381P possibly damaging Het
Mdn1 A G 4: 32,704,635 T1536A probably damaging Het
Moxd2 T A 6: 40,884,062 D265V probably damaging Het
Mtbp C A 15: 55,603,215 S541R probably benign Het
Olfr1408 C A 1: 173,130,302 C305F probably benign Het
Olfr441 T C 6: 43,116,287 S182P probably benign Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pcsk9 G T 4: 106,458,959 Q96K probably benign Het
Pramef17 T C 4: 143,991,622 Y417C probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Setd1a A G 7: 127,785,731 N585D possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Smarcal1 T C 1: 72,611,478 probably benign Het
Snx19 G T 9: 30,428,599 L344F probably benign Het
Srfbp1 T C 18: 52,488,331 C155R probably benign Het
Sspo C T 6: 48,487,353 R3914C probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tmub1 A C 5: 24,446,070 L197R probably damaging Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Tnfrsf21 G T 17: 43,087,842 R613L possibly damaging Het
Vmn2r25 A G 6: 123,839,797 I275T probably benign Het
Zfp568 G T 7: 30,022,296 C221F probably benign Het
Zfp91 C A 19: 12,778,021 E217* probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Ugt3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ugt3a2 APN 15 9367268 missense probably damaging 0.99
IGL01131:Ugt3a2 APN 15 9365162 missense probably damaging 1.00
IGL01627:Ugt3a2 APN 15 9335720 missense probably damaging 1.00
IGL01746:Ugt3a2 APN 15 9361668 missense probably damaging 1.00
IGL01949:Ugt3a2 APN 15 9335729 missense probably damaging 1.00
IGL02213:Ugt3a2 APN 15 9370224 missense probably benign 0.00
IGL02407:Ugt3a2 APN 15 9365230 nonsense probably null
IGL02588:Ugt3a2 APN 15 9361456 missense probably benign
IGL02894:Ugt3a2 APN 15 9367401 missense probably damaging 1.00
IGL02966:Ugt3a2 APN 15 9370068 missense probably damaging 1.00
IGL03385:Ugt3a2 APN 15 9338738 missense probably damaging 0.99
IGL03493:Ugt3a2 APN 15 9361483 missense probably damaging 0.96
R0554:Ugt3a2 UTSW 15 9351120 missense probably benign 0.14
R0833:Ugt3a2 UTSW 15 9370150 missense probably damaging 0.96
R1071:Ugt3a2 UTSW 15 9367368 missense possibly damaging 0.82
R1513:Ugt3a2 UTSW 15 9361524 missense probably benign 0.07
R1844:Ugt3a2 UTSW 15 9351168 missense probably benign 0.07
R1874:Ugt3a2 UTSW 15 9365351 missense probably damaging 1.00
R2305:Ugt3a2 UTSW 15 9351117 missense probably benign
R3052:Ugt3a2 UTSW 15 9365288 missense probably damaging 1.00
R3755:Ugt3a2 UTSW 15 9367412 missense probably benign 0.21
R3945:Ugt3a2 UTSW 15 9370098 missense possibly damaging 0.91
R4135:Ugt3a2 UTSW 15 9338724 missense probably damaging 0.98
R4261:Ugt3a2 UTSW 15 9335793 splice site probably null
R4570:Ugt3a2 UTSW 15 9338721 missense probably benign 0.12
R4791:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R4957:Ugt3a2 UTSW 15 9365188 missense probably benign 0.27
R5011:Ugt3a2 UTSW 15 9365287 missense probably damaging 1.00
R5035:Ugt3a2 UTSW 15 9361618 missense probably benign 0.01
R5554:Ugt3a2 UTSW 15 9370201 missense probably damaging 1.00
R5573:Ugt3a2 UTSW 15 9361683 missense probably damaging 1.00
R5631:Ugt3a2 UTSW 15 9361885 missense probably damaging 0.98
R5696:Ugt3a2 UTSW 15 9361448 splice site silent
R6265:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R6302:Ugt3a2 UTSW 15 9365311 missense probably damaging 1.00
R6311:Ugt3a2 UTSW 15 9361518 nonsense probably null
R6680:Ugt3a2 UTSW 15 9370068 missense probably damaging 1.00
R8229:Ugt3a2 UTSW 15 9367377 missense probably damaging 0.99
R8296:Ugt3a2 UTSW 15 9361938 missense probably benign 0.18
Z1177:Ugt3a2 UTSW 15 9367257 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTATGTCTTTAAGTGAAGGGC -3'
(R):5'- AGCCAAGAGTGAACTACCATG -3'

Sequencing Primer
(F):5'- TGTCTTTAAGTGAAGGGCATTATTAG -3'
(R):5'- GAGTGAACTACCATGCACAATC -3'
Posted On2015-07-21