Incidental Mutation 'R4438:Tnfrsf21'
ID329644
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 041703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4438 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43087842 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 613 (R613L)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024708
AA Change: R613L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: R613L

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T A 2: 58,477,727 I141F probably benign Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adck1 C T 12: 88,431,150 Q185* probably null Het
Adgrb3 T C 1: 25,831,027 probably benign Het
Als2cl T C 9: 110,885,398 S105P probably damaging Het
Asns C A 6: 7,675,320 A561S probably benign Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bst1 A T 5: 43,825,340 probably null Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Csnk1e A T 15: 79,420,929 S323T probably benign Het
Cyp2j7 G T 4: 96,217,409 T288K probably benign Het
Dnaaf5 T A 5: 139,163,392 I482N probably damaging Het
Dpy19l3 A G 7: 35,692,859 I636T probably damaging Het
Enpep T G 3: 129,284,091 T626P possibly damaging Het
Fgfr2 G A 7: 130,172,930 R509* probably null Het
Gm14409 T G 2: 177,265,096 Q203P possibly damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpr83 T C 9: 14,864,838 Y152H probably damaging Het
Hdac7 T C 15: 97,807,715 E400G probably damaging Het
Hypk A T 2: 121,457,994 E82V probably damaging Het
Iqub C A 6: 24,505,868 A14S probably benign Het
Lias T C 5: 65,395,444 M130T probably damaging Het
Lingo4 T C 3: 94,402,897 S381P possibly damaging Het
Mdn1 A G 4: 32,704,635 T1536A probably damaging Het
Moxd2 T A 6: 40,884,062 D265V probably damaging Het
Mtbp C A 15: 55,603,215 S541R probably benign Het
Olfr1408 C A 1: 173,130,302 C305F probably benign Het
Olfr441 T C 6: 43,116,287 S182P probably benign Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pcsk9 G T 4: 106,458,959 Q96K probably benign Het
Pramef17 T C 4: 143,991,622 Y417C probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Setd1a A G 7: 127,785,731 N585D possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Smarcal1 T C 1: 72,611,478 probably benign Het
Snx19 G T 9: 30,428,599 L344F probably benign Het
Srfbp1 T C 18: 52,488,331 C155R probably benign Het
Sspo C T 6: 48,487,353 R3914C probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tmub1 A C 5: 24,446,070 L197R probably damaging Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Ugt3a2 A T 15: 9,351,197 E97D probably benign Het
Vmn2r25 A G 6: 123,839,797 I275T probably benign Het
Zfp568 G T 7: 30,022,296 C221F probably benign Het
Zfp91 C A 19: 12,778,021 E217* probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTATTTAAAATGCCCCAGGTCAC -3'
(R):5'- GCCAGTAGGTTGATTCCCAG -3'

Sequencing Primer
(F):5'- TACTAGGTTCAGAATGCCAGC -3'
(R):5'- TGATTCCCAGAATGCAGTGC -3'
Posted On2015-07-21