Incidental Mutation 'R4438:Cdc37l1'
ID329647
Institutional Source Beutler Lab
Gene Symbol Cdc37l1
Ensembl Gene ENSMUSG00000024780
Gene Namecell division cycle 37-like 1
SynonymsHarc, 2700033A15Rik, Hsp90-associating relative of Cdc37
MMRRC Submission 041703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4438 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28990352-29026681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29007621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 224 (F224L)
Ref Sequence ENSEMBL: ENSMUSP00000153192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050148] [ENSMUST00000223694] [ENSMUST00000224511] [ENSMUST00000224599] [ENSMUST00000225210] [ENSMUST00000225310]
Predicted Effect probably damaging
Transcript: ENSMUST00000050148
AA Change: F224L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060421
Gene: ENSMUSG00000024780
AA Change: F224L

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 21 40 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
CDC37_M 132 288 7.15e-80 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183196
Predicted Effect probably benign
Transcript: ENSMUST00000223694
Predicted Effect probably benign
Transcript: ENSMUST00000224092
Predicted Effect probably damaging
Transcript: ENSMUST00000224511
AA Change: F224L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224599
AA Change: F224L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000224830
Predicted Effect probably damaging
Transcript: ENSMUST00000225210
AA Change: F224L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225310
AA Change: F224L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225598
Meta Mutation Damage Score 0.7650 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a protein related to the Hsp90 co-chaperone Cdc37. This protein may have a role in mediating interactions between the Hsp90 complex and other proteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T A 2: 58,477,727 I141F probably benign Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
Adck1 C T 12: 88,431,150 Q185* probably null Het
Adgrb3 T C 1: 25,831,027 probably benign Het
Als2cl T C 9: 110,885,398 S105P probably damaging Het
Asns C A 6: 7,675,320 A561S probably benign Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Bst1 A T 5: 43,825,340 probably null Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Csnk1e A T 15: 79,420,929 S323T probably benign Het
Cyp2j7 G T 4: 96,217,409 T288K probably benign Het
Dnaaf5 T A 5: 139,163,392 I482N probably damaging Het
Dpy19l3 A G 7: 35,692,859 I636T probably damaging Het
Enpep T G 3: 129,284,091 T626P possibly damaging Het
Fgfr2 G A 7: 130,172,930 R509* probably null Het
Gm14409 T G 2: 177,265,096 Q203P possibly damaging Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gpr83 T C 9: 14,864,838 Y152H probably damaging Het
Hdac7 T C 15: 97,807,715 E400G probably damaging Het
Hypk A T 2: 121,457,994 E82V probably damaging Het
Iqub C A 6: 24,505,868 A14S probably benign Het
Lias T C 5: 65,395,444 M130T probably damaging Het
Lingo4 T C 3: 94,402,897 S381P possibly damaging Het
Mdn1 A G 4: 32,704,635 T1536A probably damaging Het
Moxd2 T A 6: 40,884,062 D265V probably damaging Het
Mtbp C A 15: 55,603,215 S541R probably benign Het
Olfr1408 C A 1: 173,130,302 C305F probably benign Het
Olfr441 T C 6: 43,116,287 S182P probably benign Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Pcsk9 G T 4: 106,458,959 Q96K probably benign Het
Pramef17 T C 4: 143,991,622 Y417C probably damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Setd1a A G 7: 127,785,731 N585D possibly damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Smarcal1 T C 1: 72,611,478 probably benign Het
Snx19 G T 9: 30,428,599 L344F probably benign Het
Srfbp1 T C 18: 52,488,331 C155R probably benign Het
Sspo C T 6: 48,487,353 R3914C probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tmub1 A C 5: 24,446,070 L197R probably damaging Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Tnfrsf21 G T 17: 43,087,842 R613L possibly damaging Het
Ugt3a2 A T 15: 9,351,197 E97D probably benign Het
Vmn2r25 A G 6: 123,839,797 I275T probably benign Het
Zfp568 G T 7: 30,022,296 C221F probably benign Het
Zfp91 C A 19: 12,778,021 E217* probably null Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Cdc37l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Cdc37l1 APN 19 29016102 makesense probably null
R2260:Cdc37l1 UTSW 19 29007048 missense probably benign 0.05
R4043:Cdc37l1 UTSW 19 28990628 missense possibly damaging 0.83
R4434:Cdc37l1 UTSW 19 29007621 missense probably damaging 1.00
R4437:Cdc37l1 UTSW 19 29007621 missense probably damaging 1.00
R4829:Cdc37l1 UTSW 19 28990583 missense probably benign
R5385:Cdc37l1 UTSW 19 29011943 missense possibly damaging 0.95
R5537:Cdc37l1 UTSW 19 28995118 missense probably damaging 1.00
R5906:Cdc37l1 UTSW 19 29011986 missense probably benign 0.42
R7385:Cdc37l1 UTSW 19 28990671 critical splice donor site probably null
R7610:Cdc37l1 UTSW 19 29007732 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCAGAAGTAGGTAGTTATTCTGGTCC -3'
(R):5'- ACAATGTTAGCAGCCTCCTGG -3'

Sequencing Primer
(F):5'- CTGGTCCATGTAATAGCATTAAGATG -3'
(R):5'- GCTAACCAGCCTCCTGATGAG -3'
Posted On2015-07-21