Incidental Mutation 'R4439:Tnn'
ID 329651
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms tenascin-W, Tnw
MMRRC Submission 041704-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R4439 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 159912599-159981150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 159943650 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1054 (E1054D)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably benign
Transcript: ENSMUST00000039178
AA Change: E1054D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: E1054D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131919
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,384,557 (GRCm39) T2237I possibly damaging Het
Adgre1 T A 17: 57,754,954 (GRCm39) L684Q probably damaging Het
Cfap157 T A 2: 32,667,877 (GRCm39) Y488F probably benign Het
D630045J12Rik A G 6: 38,171,696 (GRCm39) I824T probably benign Het
Eno2 T C 6: 124,739,922 (GRCm39) probably benign Het
Fam78b C A 1: 166,906,491 (GRCm39) Q217K probably damaging Het
Fpgs C T 2: 32,577,513 (GRCm39) C219Y probably damaging Het
Garem2 G T 5: 30,318,344 (GRCm39) V106L possibly damaging Het
Grk3 A T 5: 113,094,543 (GRCm39) probably null Het
H3c2 A T 13: 23,936,708 (GRCm39) probably null Het
Hint2 T A 4: 43,654,919 (GRCm39) Y70F probably damaging Het
Ipp A G 4: 116,372,274 (GRCm39) N101S probably benign Het
Kcnj1 A T 9: 32,305,414 (GRCm39) probably benign Het
Kcnk4 T C 19: 6,910,129 (GRCm39) D44G probably benign Het
Kif5c T C 2: 49,578,737 (GRCm39) S122P possibly damaging Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Nipbl T A 15: 8,368,208 (GRCm39) K1171N probably damaging Het
Or4k39 T A 2: 111,239,653 (GRCm39) noncoding transcript Het
Pcf11 A C 7: 92,307,225 (GRCm39) L981R probably damaging Het
Pias2 T A 18: 77,185,399 (GRCm39) L153H probably damaging Het
Pjvk T C 2: 76,481,750 (GRCm39) S68P probably damaging Het
Pkd1 T C 17: 24,804,666 (GRCm39) V3130A probably damaging Het
Plpp4 C A 7: 128,858,813 (GRCm39) probably benign Het
Plxnd1 T A 6: 115,970,937 (GRCm39) H277L probably damaging Het
Pramel26 A T 4: 143,538,143 (GRCm39) V276E possibly damaging Het
Rasgrf2 T C 13: 92,131,797 (GRCm39) D620G possibly damaging Het
Rd3l C A 12: 111,946,092 (GRCm39) S63I possibly damaging Het
Scfd2 G C 5: 74,558,368 (GRCm39) A503G possibly damaging Het
Slco4a1 T C 2: 180,114,455 (GRCm39) V549A probably benign Het
Tenm4 A G 7: 96,545,022 (GRCm39) N2375S probably benign Het
Tespa1 C T 10: 130,197,826 (GRCm39) R283C probably damaging Het
Tle2 A G 10: 81,417,516 (GRCm39) E227G possibly damaging Het
Tnrc6a A T 7: 122,751,405 (GRCm39) K54* probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpr T A 1: 150,279,712 (GRCm39) D206E probably benign Het
Ugt2b34 A T 5: 87,040,726 (GRCm39) F399I probably damaging Het
Usp3 A T 9: 66,425,776 (GRCm39) D456E probably benign Het
Vmn1r60 T A 7: 5,547,488 (GRCm39) H204L probably damaging Het
Vmn2r97 G T 17: 19,150,616 (GRCm39) A488S probably benign Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wdr86 T C 5: 24,935,235 (GRCm39) D36G probably damaging Het
Zc3h4 C T 7: 16,163,036 (GRCm39) P479S unknown Het
Zfhx4 A T 3: 5,279,875 (GRCm39) probably benign Het
Zfp607b T A 7: 27,402,149 (GRCm39) C202S probably damaging Het
Zfp882 T A 8: 72,667,453 (GRCm39) F93L probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 159,953,021 (GRCm39) missense possibly damaging 0.65
IGL00433:Tnn APN 1 159,925,776 (GRCm39) splice site probably benign
IGL00858:Tnn APN 1 159,915,962 (GRCm39) critical splice donor site probably null
IGL00939:Tnn APN 1 159,975,100 (GRCm39) missense probably damaging 1.00
IGL01569:Tnn APN 1 159,948,124 (GRCm39) missense possibly damaging 0.51
IGL01591:Tnn APN 1 159,953,144 (GRCm39) missense probably damaging 1.00
IGL01628:Tnn APN 1 159,975,172 (GRCm39) missense possibly damaging 0.89
IGL01811:Tnn APN 1 159,934,705 (GRCm39) missense probably damaging 1.00
IGL01813:Tnn APN 1 159,916,008 (GRCm39) missense probably damaging 1.00
IGL02340:Tnn APN 1 159,972,775 (GRCm39) missense probably benign 0.00
IGL02488:Tnn APN 1 159,968,163 (GRCm39) missense probably benign 0.21
IGL02535:Tnn APN 1 159,950,222 (GRCm39) splice site probably null
IGL02563:Tnn APN 1 159,942,123 (GRCm39) missense probably damaging 1.00
IGL02572:Tnn APN 1 159,913,677 (GRCm39) missense probably damaging 1.00
IGL02740:Tnn APN 1 159,968,347 (GRCm39) splice site probably benign
IGL02818:Tnn APN 1 159,943,848 (GRCm39) missense possibly damaging 0.86
IGL03284:Tnn APN 1 159,953,022 (GRCm39) missense probably benign 0.01
1mM(1):Tnn UTSW 1 159,924,911 (GRCm39) missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 159,913,647 (GRCm39) missense possibly damaging 0.91
R0023:Tnn UTSW 1 159,932,498 (GRCm39) missense probably benign 0.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0316:Tnn UTSW 1 159,948,137 (GRCm39) missense possibly damaging 0.93
R0492:Tnn UTSW 1 159,948,327 (GRCm39) missense probably damaging 0.99
R0547:Tnn UTSW 1 159,943,907 (GRCm39) intron probably benign
R1067:Tnn UTSW 1 159,952,968 (GRCm39) missense probably damaging 1.00
R1563:Tnn UTSW 1 159,952,985 (GRCm39) missense probably damaging 1.00
R1565:Tnn UTSW 1 159,924,835 (GRCm39) missense probably damaging 1.00
R1615:Tnn UTSW 1 159,945,978 (GRCm39) missense possibly damaging 0.93
R1637:Tnn UTSW 1 159,975,170 (GRCm39) missense probably damaging 1.00
R1707:Tnn UTSW 1 159,972,714 (GRCm39) missense probably damaging 1.00
R1758:Tnn UTSW 1 159,975,154 (GRCm39) missense possibly damaging 0.61
R1797:Tnn UTSW 1 159,968,258 (GRCm39) missense probably damaging 1.00
R1847:Tnn UTSW 1 159,943,752 (GRCm39) missense possibly damaging 0.51
R1925:Tnn UTSW 1 159,924,799 (GRCm39) missense probably damaging 1.00
R2182:Tnn UTSW 1 159,968,170 (GRCm39) splice site probably null
R2196:Tnn UTSW 1 159,924,798 (GRCm39) nonsense probably null
R2225:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2227:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2286:Tnn UTSW 1 159,938,079 (GRCm39) missense possibly damaging 0.89
R2850:Tnn UTSW 1 159,966,857 (GRCm39) missense probably benign 0.00
R3110:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3111:Tnn UTSW 1 159,934,625 (GRCm39) missense probably damaging 0.98
R3112:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3729:Tnn UTSW 1 159,973,810 (GRCm39) missense probably damaging 1.00
R4183:Tnn UTSW 1 159,924,925 (GRCm39) missense probably damaging 1.00
R4441:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4588:Tnn UTSW 1 159,972,681 (GRCm39) missense probably benign 0.25
R4646:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4647:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4648:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4701:Tnn UTSW 1 159,975,338 (GRCm39) missense possibly damaging 0.72
R4703:Tnn UTSW 1 159,943,815 (GRCm39) missense possibly damaging 0.84
R4737:Tnn UTSW 1 159,973,659 (GRCm39) missense probably damaging 1.00
R4801:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4802:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4868:Tnn UTSW 1 159,958,443 (GRCm39) missense possibly damaging 0.64
R4977:Tnn UTSW 1 159,948,188 (GRCm39) missense probably damaging 1.00
R5011:Tnn UTSW 1 159,953,949 (GRCm39) missense possibly damaging 0.89
R5026:Tnn UTSW 1 159,973,707 (GRCm39) missense probably benign 0.00
R5027:Tnn UTSW 1 159,972,781 (GRCm39) missense probably damaging 1.00
R5049:Tnn UTSW 1 159,968,308 (GRCm39) missense probably benign 0.00
R5119:Tnn UTSW 1 159,948,122 (GRCm39) missense probably damaging 0.98
R5128:Tnn UTSW 1 159,950,464 (GRCm39) missense probably damaging 0.98
R5234:Tnn UTSW 1 159,972,569 (GRCm39) missense possibly damaging 0.95
R5398:Tnn UTSW 1 159,975,092 (GRCm39) missense probably benign 0.00
R5424:Tnn UTSW 1 159,950,272 (GRCm39) missense possibly damaging 0.69
R5452:Tnn UTSW 1 159,937,831 (GRCm39) missense probably benign 0.13
R5466:Tnn UTSW 1 159,948,106 (GRCm39) missense possibly damaging 0.93
R6022:Tnn UTSW 1 159,937,928 (GRCm39) missense probably benign 0.00
R6062:Tnn UTSW 1 159,925,848 (GRCm39) missense probably damaging 1.00
R6086:Tnn UTSW 1 159,913,690 (GRCm39) missense probably damaging 1.00
R6132:Tnn UTSW 1 159,973,641 (GRCm39) missense probably damaging 0.96
R6324:Tnn UTSW 1 159,972,774 (GRCm39) missense probably damaging 0.96
R6455:Tnn UTSW 1 159,942,289 (GRCm39) missense probably damaging 1.00
R6563:Tnn UTSW 1 159,915,968 (GRCm39) missense probably damaging 1.00
R6650:Tnn UTSW 1 159,942,153 (GRCm39) missense probably damaging 1.00
R6806:Tnn UTSW 1 159,948,278 (GRCm39) missense possibly damaging 0.95
R6810:Tnn UTSW 1 159,932,412 (GRCm39) missense probably damaging 1.00
R7157:Tnn UTSW 1 159,953,947 (GRCm39) nonsense probably null
R7243:Tnn UTSW 1 159,934,687 (GRCm39) missense probably benign 0.07
R7340:Tnn UTSW 1 159,973,592 (GRCm39) missense probably damaging 0.98
R7472:Tnn UTSW 1 159,937,917 (GRCm39) missense probably benign 0.12
R7502:Tnn UTSW 1 159,937,929 (GRCm39) missense probably benign 0.00
R7527:Tnn UTSW 1 159,946,074 (GRCm39) missense possibly damaging 0.51
R7608:Tnn UTSW 1 159,915,984 (GRCm39) nonsense probably null
R7746:Tnn UTSW 1 159,942,255 (GRCm39) missense probably damaging 0.97
R8096:Tnn UTSW 1 159,950,411 (GRCm39) missense probably damaging 1.00
R8136:Tnn UTSW 1 159,934,630 (GRCm39) missense probably damaging 0.96
R8191:Tnn UTSW 1 159,953,088 (GRCm39) missense probably damaging 1.00
R8334:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8335:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8337:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8338:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8427:Tnn UTSW 1 159,958,256 (GRCm39) missense probably damaging 0.99
R8433:Tnn UTSW 1 159,924,790 (GRCm39) missense possibly damaging 0.81
R8479:Tnn UTSW 1 159,950,397 (GRCm39) missense probably benign 0.06
R8505:Tnn UTSW 1 159,973,593 (GRCm39) missense probably damaging 0.98
R8554:Tnn UTSW 1 159,937,986 (GRCm39) missense probably damaging 1.00
R8717:Tnn UTSW 1 159,943,846 (GRCm39) missense possibly damaging 0.51
R8850:Tnn UTSW 1 159,937,814 (GRCm39) critical splice donor site probably null
R8928:Tnn UTSW 1 159,953,099 (GRCm39) missense probably damaging 1.00
R9209:Tnn UTSW 1 159,953,986 (GRCm39) missense probably benign 0.02
X0019:Tnn UTSW 1 159,913,716 (GRCm39) missense probably damaging 1.00
Z1176:Tnn UTSW 1 159,973,863 (GRCm39) missense probably benign
Z1177:Tnn UTSW 1 159,954,097 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAGCACATAAGGAAACCAGTTTC -3'
(R):5'- AGACCACTCTCAGTGTCTCC -3'

Sequencing Primer
(F):5'- CCAGTTTCAGGGAGTAAGGAATG -3'
(R):5'- GACCCAGTACAGGCTGACATTG -3'
Posted On 2015-07-21