Incidental Mutation 'R4439:Olfr1285'
ID329658
Institutional Source Beutler Lab
Gene Symbol Olfr1285
Ensembl Gene ENSMUSG00000062280
Gene Nameolfactory receptor 1285
SynonymsMOR248-17P, MOR248-25_p, GA_x6K02T2Q125-72459956-72460837
MMRRC Submission 041704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4439 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111408376-111409331 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 111409308 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000184954]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184954
AA Change: H311Q
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: H311Q

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220153
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,246,496 T2237I possibly damaging Het
Adgre1 T A 17: 57,447,954 L684Q probably damaging Het
Cfap157 T A 2: 32,777,865 Y488F probably benign Het
D630045J12Rik A G 6: 38,194,761 I824T probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Eno2 T C 6: 124,762,959 probably benign Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Garem2 G T 5: 30,113,346 V106L possibly damaging Het
Gm13084 A T 4: 143,811,573 V276E possibly damaging Het
Grk3 A T 5: 112,946,677 probably null Het
Hint2 T A 4: 43,654,919 Y70F probably damaging Het
Hist1h3b A T 13: 23,752,725 probably null Het
Ipp A G 4: 116,515,077 N101S probably benign Het
Kcnj1 A T 9: 32,394,118 probably benign Het
Kcnk4 T C 19: 6,932,761 D44G probably benign Het
Kif5c T C 2: 49,688,725 S122P possibly damaging Het
Nipbl T A 15: 8,338,724 K1171N probably damaging Het
Pcf11 A C 7: 92,658,017 L981R probably damaging Het
Pias2 T A 18: 77,097,703 L153H probably damaging Het
Pjvk T C 2: 76,651,406 S68P probably damaging Het
Pkd1 T C 17: 24,585,692 V3130A probably damaging Het
Plpp4 C A 7: 129,257,089 probably benign Het
Plxnd1 T A 6: 115,993,976 H277L probably damaging Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rd3l C A 12: 111,979,658 S63I possibly damaging Het
Scfd2 G C 5: 74,397,707 A503G possibly damaging Het
Slco4a1 T C 2: 180,472,662 V549A probably benign Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tnrc6a A T 7: 123,152,182 K54* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpr T A 1: 150,403,961 D206E probably benign Het
Ugt2b34 A T 5: 86,892,867 F399I probably damaging Het
Usp3 A T 9: 66,518,494 D456E probably benign Het
Vmn1r60 T A 7: 5,544,489 H204L probably damaging Het
Vmn2r97 G T 17: 18,930,354 A488S probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr86 T C 5: 24,730,237 D36G probably damaging Het
Zc3h4 C T 7: 16,429,111 P479S unknown Het
Zfhx4 A T 3: 5,214,815 probably benign Het
Zfp607b T A 7: 27,702,724 C202S probably damaging Het
Zfp882 T A 8: 71,913,609 F93L probably damaging Het
Other mutations in Olfr1285
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1285 APN 2 111409219 missense probably damaging 1.00
IGL01819:Olfr1285 APN 2 111408733 missense probably damaging 0.99
IGL02109:Olfr1285 APN 2 111408493 exon noncoding transcript
IGL02407:Olfr1285 APN 2 111408578 exon noncoding transcript
R0054:Olfr1285 UTSW 2 111408795 missense probably benign 0.00
R1665:Olfr1285 UTSW 2 111408753 missense probably damaging 1.00
R2339:Olfr1285 UTSW 2 111409189 missense probably benign 0.36
R3876:Olfr1285 UTSW 2 111408622 missense possibly damaging 0.57
R4260:Olfr1285 UTSW 2 111408505 exon noncoding transcript
R4762:Olfr1285 UTSW 2 111408880 exon noncoding transcript
R4821:Olfr1285 UTSW 2 111409225 exon noncoding transcript
R5120:Olfr1285 UTSW 2 111409240 exon noncoding transcript
R5215:Olfr1285 UTSW 2 111409286 exon noncoding transcript
R5244:Olfr1285 UTSW 2 111408554 exon noncoding transcript
R5667:Olfr1285 UTSW 2 111408473 exon noncoding transcript
R5671:Olfr1285 UTSW 2 111408473 exon noncoding transcript
R5687:Olfr1285 UTSW 2 111408688 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCATATCATAGTGGTTCTGCTGTTC -3'
(R):5'- AAGTGGATCCCGGATATCAAAG -3'

Sequencing Primer
(F):5'- GCTGTTCTTTGGGCCCATC -3'
(R):5'- GGATCCCGGATATCAAAGTTTTTCC -3'
Posted On2015-07-21