Incidental Mutation 'R4439:Acacb'
ID329669
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission 041704-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4439 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114246496 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2237 (T2237I)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031583
AA Change: T2237I

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: T2237I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102582
AA Change: T2237I

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: T2237I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 T A 17: 57,447,954 L684Q probably damaging Het
Cfap157 T A 2: 32,777,865 Y488F probably benign Het
D630045J12Rik A G 6: 38,194,761 I824T probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Eno2 T C 6: 124,762,959 probably benign Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Garem2 G T 5: 30,113,346 V106L possibly damaging Het
Gm13084 A T 4: 143,811,573 V276E possibly damaging Het
Grk3 A T 5: 112,946,677 probably null Het
Hint2 T A 4: 43,654,919 Y70F probably damaging Het
Hist1h3b A T 13: 23,752,725 probably null Het
Ipp A G 4: 116,515,077 N101S probably benign Het
Kcnj1 A T 9: 32,394,118 probably benign Het
Kcnk4 T C 19: 6,932,761 D44G probably benign Het
Kif5c T C 2: 49,688,725 S122P possibly damaging Het
Nipbl T A 15: 8,338,724 K1171N probably damaging Het
Olfr1285 T A 2: 111,409,308 noncoding transcript Het
Pcf11 A C 7: 92,658,017 L981R probably damaging Het
Pias2 T A 18: 77,097,703 L153H probably damaging Het
Pjvk T C 2: 76,651,406 S68P probably damaging Het
Pkd1 T C 17: 24,585,692 V3130A probably damaging Het
Plpp4 C A 7: 129,257,089 probably benign Het
Plxnd1 T A 6: 115,993,976 H277L probably damaging Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rd3l C A 12: 111,979,658 S63I possibly damaging Het
Scfd2 G C 5: 74,397,707 A503G possibly damaging Het
Slco4a1 T C 2: 180,472,662 V549A probably benign Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tnrc6a A T 7: 123,152,182 K54* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpr T A 1: 150,403,961 D206E probably benign Het
Ugt2b34 A T 5: 86,892,867 F399I probably damaging Het
Usp3 A T 9: 66,518,494 D456E probably benign Het
Vmn1r60 T A 7: 5,544,489 H204L probably damaging Het
Vmn2r97 G T 17: 18,930,354 A488S probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr86 T C 5: 24,730,237 D36G probably damaging Het
Zc3h4 C T 7: 16,429,111 P479S unknown Het
Zfhx4 A T 3: 5,214,815 probably benign Het
Zfp607b T A 7: 27,702,724 C202S probably damaging Het
Zfp882 T A 8: 71,913,609 F93L probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGGCATGTACGCAGATAC -3'
(R):5'- TCCTATGTGACCTGGGCATG -3'

Sequencing Primer
(F):5'- GGCATGTACGCAGATACACATAC -3'
(R):5'- GACTTGGGGGTGGAGCC -3'
Posted On2015-07-21