Mutagenetix > Incidental Mutation

Incidental Mutation 'R4439:Plxnd1'

329671

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

6230425C21Rik, b2b1863Clo, b2b553Clo

MMRRC Submission

041704-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4439 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

115931772-115971966 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115970937 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 277 (H277L)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably damaging
Transcript: ENSMUST00000015511
AA Change: H277L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: H277L

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Meta Mutation Damage Score

0.1989

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

94% (50/53)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	C	T	5: 114,384,557 (GRCm39)	T2237I	possibly damaging	Het
Adgre1	T	A	17: 57,754,954 (GRCm39)	L684Q	probably damaging	Het
Cfap157	T	A	2: 32,667,877 (GRCm39)	Y488F	probably benign	Het
D630045J12Rik	A	G	6: 38,171,696 (GRCm39)	I824T	probably benign	Het
Eno2	T	C	6: 124,739,922 (GRCm39)		probably benign	Het
Fam78b	C	A	1: 166,906,491 (GRCm39)	Q217K	probably damaging	Het
Fpgs	C	T	2: 32,577,513 (GRCm39)	C219Y	probably damaging	Het
Garem2	G	T	5: 30,318,344 (GRCm39)	V106L	possibly damaging	Het
Grk3	A	T	5: 113,094,543 (GRCm39)		probably null	Het
H3c2	A	T	13: 23,936,708 (GRCm39)		probably null	Het
Hint2	T	A	4: 43,654,919 (GRCm39)	Y70F	probably damaging	Het
Ipp	A	G	4: 116,372,274 (GRCm39)	N101S	probably benign	Het
Kcnj1	A	T	9: 32,305,414 (GRCm39)		probably benign	Het
Kcnk4	T	C	19: 6,910,129 (GRCm39)	D44G	probably benign	Het
Kif5c	T	C	2: 49,578,737 (GRCm39)	S122P	possibly damaging	Het
Mideas	C	T	12: 84,203,245 (GRCm39)	G886S	probably benign	Het
Nipbl	T	A	15: 8,368,208 (GRCm39)	K1171N	probably damaging	Het
Or4k39	T	A	2: 111,239,653 (GRCm39)		noncoding transcript	Het
Pcf11	A	C	7: 92,307,225 (GRCm39)	L981R	probably damaging	Het
Pias2	T	A	18: 77,185,399 (GRCm39)	L153H	probably damaging	Het
Pjvk	T	C	2: 76,481,750 (GRCm39)	S68P	probably damaging	Het
Pkd1	T	C	17: 24,804,666 (GRCm39)	V3130A	probably damaging	Het
Plpp4	C	A	7: 128,858,813 (GRCm39)		probably benign	Het
Pramel26	A	T	4: 143,538,143 (GRCm39)	V276E	possibly damaging	Het
Rasgrf2	T	C	13: 92,131,797 (GRCm39)	D620G	possibly damaging	Het
Rd3l	C	A	12: 111,946,092 (GRCm39)	S63I	possibly damaging	Het
Scfd2	G	C	5: 74,558,368 (GRCm39)	A503G	possibly damaging	Het
Slco4a1	T	C	2: 180,114,455 (GRCm39)	V549A	probably benign	Het
Tenm4	A	G	7: 96,545,022 (GRCm39)	N2375S	probably benign	Het
Tespa1	C	T	10: 130,197,826 (GRCm39)	R283C	probably damaging	Het
Tle2	A	G	10: 81,417,516 (GRCm39)	E227G	possibly damaging	Het
Tnn	T	G	1: 159,943,650 (GRCm39)	E1054D	probably benign	Het
Tnrc6a	A	T	7: 122,751,405 (GRCm39)	K54*	probably null	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Tpr	T	A	1: 150,279,712 (GRCm39)	D206E	probably benign	Het
Ugt2b34	A	T	5: 87,040,726 (GRCm39)	F399I	probably damaging	Het
Usp3	A	T	9: 66,425,776 (GRCm39)	D456E	probably benign	Het
Vmn1r60	T	A	7: 5,547,488 (GRCm39)	H204L	probably damaging	Het
Vmn2r97	G	T	17: 19,150,616 (GRCm39)	A488S	probably benign	Het
Vrk3	C	T	7: 44,424,866 (GRCm39)	T427M	probably benign	Het
Wdr86	T	C	5: 24,935,235 (GRCm39)	D36G	probably damaging	Het
Zc3h4	C	T	7: 16,163,036 (GRCm39)	P479S	unknown	Het
Zfhx4	A	T	3: 5,279,875 (GRCm39)		probably benign	Het
Zfp607b	T	A	7: 27,402,149 (GRCm39)	C202S	probably damaging	Het
Zfp882	T	A	8: 72,667,453 (GRCm39)	F93L	probably damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115,944,933 (GRCm39)	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115,946,906 (GRCm39)	missense	probably benign
IGL01323:Plxnd1	APN	6	115,943,760 (GRCm39)	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115,937,488 (GRCm39)	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115,936,896 (GRCm39)	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115,955,218 (GRCm39)	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115,970,589 (GRCm39)	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115,940,874 (GRCm39)	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115,932,703 (GRCm39)	makesense	probably null
IGL02873:Plxnd1	APN	6	115,936,937 (GRCm39)	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115,939,318 (GRCm39)	missense	probably damaging	1.00
Hiss	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
murmer	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
mutter	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
rattle	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115,946,421 (GRCm39)	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115,935,660 (GRCm39)	splice site	probably benign
R0648:Plxnd1	UTSW	6	115,970,962 (GRCm39)	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115,943,599 (GRCm39)	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115,943,966 (GRCm39)	splice site	probably null
R1292:Plxnd1	UTSW	6	115,939,644 (GRCm39)	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115,945,642 (GRCm39)	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115,944,740 (GRCm39)	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115,971,018 (GRCm39)	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115,957,562 (GRCm39)	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115,943,507 (GRCm39)	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115,940,875 (GRCm39)	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1865:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1875:Plxnd1	UTSW	6	115,955,045 (GRCm39)	splice site	probably null
R1899:Plxnd1	UTSW	6	115,946,324 (GRCm39)	missense	probably benign
R1913:Plxnd1	UTSW	6	115,954,978 (GRCm39)	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115,939,478 (GRCm39)	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115,944,216 (GRCm39)	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115,934,509 (GRCm39)	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115,939,725 (GRCm39)	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115,941,105 (GRCm39)	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115,939,704 (GRCm39)	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115,944,709 (GRCm39)	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115,936,276 (GRCm39)	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115,942,914 (GRCm39)	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115,933,056 (GRCm39)	splice site	probably null
R4280:Plxnd1	UTSW	6	115,933,055 (GRCm39)	splice site	probably benign
R4346:Plxnd1	UTSW	6	115,954,941 (GRCm39)	missense	probably benign	0.16
R4572:Plxnd1	UTSW	6	115,932,717 (GRCm39)	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115,971,237 (GRCm39)	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115,949,486 (GRCm39)	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115,935,576 (GRCm39)	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115,935,581 (GRCm39)	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115,937,816 (GRCm39)	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115,932,726 (GRCm39)	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115,971,337 (GRCm39)	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115,942,862 (GRCm39)	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115,935,949 (GRCm39)	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115,934,609 (GRCm39)	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115,942,838 (GRCm39)	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115,945,649 (GRCm39)	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115,944,748 (GRCm39)	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115,955,135 (GRCm39)	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115,954,921 (GRCm39)	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115,955,453 (GRCm39)	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115,953,697 (GRCm39)	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115,970,724 (GRCm39)	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115,949,468 (GRCm39)	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115,937,798 (GRCm39)	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115,953,600 (GRCm39)	missense	probably benign
R7699:Plxnd1	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115,943,879 (GRCm39)	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115,933,578 (GRCm39)	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115,949,433 (GRCm39)	missense	probably benign
R8507:Plxnd1	UTSW	6	115,943,866 (GRCm39)	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115,939,768 (GRCm39)	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115,934,558 (GRCm39)	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115,949,506 (GRCm39)	nonsense	probably null
R9119:Plxnd1	UTSW	6	115,932,832 (GRCm39)	splice site	probably benign
R9177:Plxnd1	UTSW	6	115,943,469 (GRCm39)	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115,970,746 (GRCm39)	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115,934,526 (GRCm39)	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115,934,524 (GRCm39)	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115,932,730 (GRCm39)	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115,940,277 (GRCm39)	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115,940,271 (GRCm39)	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115,943,745 (GRCm39)	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115,944,471 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGCCCAGTTGGATGTAGGACTC -3'
(R):5'- TGTTCCCCAGCATGCTCAAC -3'

Sequencing Primer
(F):5'- ATGTAGGACTCGGTGAGCTTC -3'
(R):5'- AGCATGCTCAACGTGGC -3'

Posted On

2015-07-21