Mutagenetix > Incidental Mutations

Incidental Mutation 'R4439:Tnrc6a'

329679

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6a

Ensembl Gene

ENSMUSG00000052707

Gene Name

trinucleotide repeat containing 6a

Synonyms

CAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik

MMRRC Submission

041704-MU

Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene?

Probably essential (E-score: 0.820) question?

Stock #

R4439 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

123123885-123195296 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 123152182 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 54 (K54*)

Ref Sequence

ENSEMBL: ENSMUSP00000091595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206888]

Predicted Effect

probably null
Transcript: ENSMUST00000094053
AA Change: K54*

SMART Domains

Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: K54*

Domain	Start	End	E-Value	Type
coiled coil region	5	54	N/A	INTRINSIC
low complexity region	69	92	N/A	INTRINSIC
low complexity region	93	113	N/A	INTRINSIC
low complexity region	281	294	N/A	INTRINSIC
low complexity region	430	443	N/A	INTRINSIC
low complexity region	568	590	N/A	INTRINSIC
internal_repeat_1	690	853	3.51e-6	PROSPERO
low complexity region	858	871	N/A	INTRINSIC
Pfam:Ago_hook	1028	1190	1.2e-29	PFAM
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1301	1316	N/A	INTRINSIC
low complexity region	1337	1376	N/A	INTRINSIC
low complexity region	1386	1392	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1439	1714	1.5e-126	PFAM
RRM	1717	1784	4.95e-2	SMART
low complexity region	1808	1820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205514

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206458

Predicted Effect

probably benign
Transcript: ENSMUST00000206888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211170

Meta Mutation Damage Score

0.9713

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]

Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	C	T	5: 114,246,496	T2237I	possibly damaging	Het
Adgre1	T	A	17: 57,447,954	L684Q	probably damaging	Het
Cfap157	T	A	2: 32,777,865	Y488F	probably benign	Het
D630045J12Rik	A	G	6: 38,194,761	I824T	probably benign	Het
Elmsan1	C	T	12: 84,156,471	G886S	probably benign	Het
Eno2	T	C	6: 124,762,959		probably benign	Het
Fam78b	C	A	1: 167,078,922	Q217K	probably damaging	Het
Fpgs	C	T	2: 32,687,501	C219Y	probably damaging	Het
Garem2	G	T	5: 30,113,346	V106L	possibly damaging	Het
Gm13084	A	T	4: 143,811,573	V276E	possibly damaging	Het
Grk3	A	T	5: 112,946,677		probably null	Het
Hint2	T	A	4: 43,654,919	Y70F	probably damaging	Het
Hist1h3b	A	T	13: 23,752,725		probably null	Het
Ipp	A	G	4: 116,515,077	N101S	probably benign	Het
Kcnj1	A	T	9: 32,394,118		probably benign	Het
Kcnk4	T	C	19: 6,932,761	D44G	probably benign	Het
Kif5c	T	C	2: 49,688,725	S122P	possibly damaging	Het
Nipbl	T	A	15: 8,338,724	K1171N	probably damaging	Het
Olfr1285	T	A	2: 111,409,308		noncoding transcript	Het
Pcf11	A	C	7: 92,658,017	L981R	probably damaging	Het
Pias2	T	A	18: 77,097,703	L153H	probably damaging	Het
Pjvk	T	C	2: 76,651,406	S68P	probably damaging	Het
Pkd1	T	C	17: 24,585,692	V3130A	probably damaging	Het
Plpp4	C	A	7: 129,257,089		probably benign	Het
Plxnd1	T	A	6: 115,993,976	H277L	probably damaging	Het
Rasgrf2	T	C	13: 91,983,678	D620G	possibly damaging	Het
Rd3l	C	A	12: 111,979,658	S63I	possibly damaging	Het
Scfd2	G	C	5: 74,397,707	A503G	possibly damaging	Het
Slco4a1	T	C	2: 180,472,662	V549A	probably benign	Het
Tenm4	A	G	7: 96,895,815	N2375S	probably benign	Het
Tespa1	C	T	10: 130,361,957	R283C	probably damaging	Het
Tle2	A	G	10: 81,581,682	E227G	possibly damaging	Het
Tnn	T	G	1: 160,116,080	E1054D	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpr	T	A	1: 150,403,961	D206E	probably benign	Het
Ugt2b34	A	T	5: 86,892,867	F399I	probably damaging	Het
Usp3	A	T	9: 66,518,494	D456E	probably benign	Het
Vmn1r60	T	A	7: 5,544,489	H204L	probably damaging	Het
Vmn2r97	G	T	17: 18,930,354	A488S	probably benign	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wdr86	T	C	5: 24,730,237	D36G	probably damaging	Het
Zc3h4	C	T	7: 16,429,111	P479S	unknown	Het
Zfhx4	A	T	3: 5,214,815		probably benign	Het
Zfp607b	T	A	7: 27,702,724	C202S	probably damaging	Het
Zfp882	T	A	8: 71,913,609	F93L	probably damaging	Het

Other mutations in Tnrc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Tnrc6a	APN	7	123170780	missense	probably benign	0.04
IGL00580:Tnrc6a	APN	7	123174278	missense	probably damaging	1.00
IGL01309:Tnrc6a	APN	7	123171494	missense	probably benign	0.04
IGL02004:Tnrc6a	APN	7	123181366	missense	possibly damaging	0.57
IGL02142:Tnrc6a	APN	7	123152191	intron	probably benign
IGL02220:Tnrc6a	APN	7	123170456	missense	probably benign
IGL02436:Tnrc6a	APN	7	123184215	nonsense	probably null
IGL02670:Tnrc6a	APN	7	123171312	missense	possibly damaging	0.92
IGL02743:Tnrc6a	APN	7	123171473	missense	probably damaging	1.00
0152:Tnrc6a	UTSW	7	123180654	missense	probably damaging	1.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0369:Tnrc6a	UTSW	7	123170860	missense	probably damaging	1.00
R0512:Tnrc6a	UTSW	7	123186728	splice site	probably benign
R0566:Tnrc6a	UTSW	7	123170913	missense	probably benign	0.00
R0600:Tnrc6a	UTSW	7	123171816	missense	probably benign	0.14
R0751:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1184:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1319:Tnrc6a	UTSW	7	123184251	missense	probably benign	0.02
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1585:Tnrc6a	UTSW	7	123176875	missense	probably benign	0.08
R1709:Tnrc6a	UTSW	7	123169982	missense	probably benign	0.10
R1776:Tnrc6a	UTSW	7	123171297	missense	probably damaging	1.00
R1791:Tnrc6a	UTSW	7	123192917	missense	possibly damaging	0.47
R1807:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R1876:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2010:Tnrc6a	UTSW	7	123171046	missense	probably benign	0.26
R2086:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2089:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2511:Tnrc6a	UTSW	7	123171092	missense	probably damaging	1.00
R2830:Tnrc6a	UTSW	7	123192949	makesense	probably null
R2850:Tnrc6a	UTSW	7	123179800	missense	probably damaging	1.00
R3916:Tnrc6a	UTSW	7	123181384	missense	probably damaging	1.00
R4028:Tnrc6a	UTSW	7	123170121	missense	probably damaging	1.00
R4235:Tnrc6a	UTSW	7	123171680	missense	probably benign	0.00
R4525:Tnrc6a	UTSW	7	123179782	missense	probably benign
R4578:Tnrc6a	UTSW	7	123184221	missense	possibly damaging	0.89
R4613:Tnrc6a	UTSW	7	123184289	critical splice donor site	probably null
R4711:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R4722:Tnrc6a	UTSW	7	123192090	missense	possibly damaging	0.78
R4746:Tnrc6a	UTSW	7	123189997	missense	probably damaging	1.00
R4892:Tnrc6a	UTSW	7	123169911	missense	probably damaging	1.00
R4942:Tnrc6a	UTSW	7	123192613	missense	probably damaging	0.99
R4967:Tnrc6a	UTSW	7	123189872	missense	probably damaging	1.00
R5064:Tnrc6a	UTSW	7	123186723	critical splice donor site	probably null
R5239:Tnrc6a	UTSW	7	123186619	missense	probably benign
R5604:Tnrc6a	UTSW	7	123174236	missense	probably damaging	0.97
R5805:Tnrc6a	UTSW	7	123170076	missense	probably damaging	0.97
R5942:Tnrc6a	UTSW	7	123186665	missense	probably damaging	1.00
R5988:Tnrc6a	UTSW	7	123182380	missense	probably damaging	0.96
R6212:Tnrc6a	UTSW	7	123143742	splice site	probably null
R6284:Tnrc6a	UTSW	7	123171335	missense	probably damaging	0.99
R6417:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6420:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6575:Tnrc6a	UTSW	7	123169910	missense	probably damaging	1.00
R6760:Tnrc6a	UTSW	7	123171999	missense	probably damaging	1.00
R6886:Tnrc6a	UTSW	7	123187445	missense	probably benign	0.17
R6968:Tnrc6a	UTSW	7	123182427	missense	probably benign	0.05
R7216:Tnrc6a	UTSW	7	123171495	missense	probably benign	0.01
R7260:Tnrc6a	UTSW	7	123186590	missense	probably benign	0.36
R7299:Tnrc6a	UTSW	7	123170913	missense	probably benign
R7322:Tnrc6a	UTSW	7	123171508	missense	probably benign	0.09
R7500:Tnrc6a	UTSW	7	123173450	intron	probably null
R7872:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
R7955:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
X0064:Tnrc6a	UTSW	7	123169798	missense	probably benign	0.28
Z1176:Tnrc6a	UTSW	7	123162496	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAATGGGGCACATCTGTAG -3'
(R):5'- GACAGCATCTTCTCCATGTGG -3'

Sequencing Primer
(F):5'- CTGTAGGAAAAGAATGCTTGCATGTC -3'
(R):5'- CCCATCCTGAAGGTGAAT -3'

Posted On

2015-07-21