Incidental Mutation 'R4439:Rasgrf2'
ID 329690
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
MMRRC Submission 041704-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R4439 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92131797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 620 (D620G)
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
AlphaFold P70392
Predicted Effect possibly damaging
Transcript: ENSMUST00000099326
AA Change: D620G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D620G

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142378
AA Change: D19G
SMART Domains Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: D19G

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
Blast:RasGEFN 187 249 8e-29 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000151408
AA Change: D19G
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D19G

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.2853 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,384,557 (GRCm39) T2237I possibly damaging Het
Adgre1 T A 17: 57,754,954 (GRCm39) L684Q probably damaging Het
Cfap157 T A 2: 32,667,877 (GRCm39) Y488F probably benign Het
D630045J12Rik A G 6: 38,171,696 (GRCm39) I824T probably benign Het
Eno2 T C 6: 124,739,922 (GRCm39) probably benign Het
Fam78b C A 1: 166,906,491 (GRCm39) Q217K probably damaging Het
Fpgs C T 2: 32,577,513 (GRCm39) C219Y probably damaging Het
Garem2 G T 5: 30,318,344 (GRCm39) V106L possibly damaging Het
Grk3 A T 5: 113,094,543 (GRCm39) probably null Het
H3c2 A T 13: 23,936,708 (GRCm39) probably null Het
Hint2 T A 4: 43,654,919 (GRCm39) Y70F probably damaging Het
Ipp A G 4: 116,372,274 (GRCm39) N101S probably benign Het
Kcnj1 A T 9: 32,305,414 (GRCm39) probably benign Het
Kcnk4 T C 19: 6,910,129 (GRCm39) D44G probably benign Het
Kif5c T C 2: 49,578,737 (GRCm39) S122P possibly damaging Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Nipbl T A 15: 8,368,208 (GRCm39) K1171N probably damaging Het
Or4k39 T A 2: 111,239,653 (GRCm39) noncoding transcript Het
Pcf11 A C 7: 92,307,225 (GRCm39) L981R probably damaging Het
Pias2 T A 18: 77,185,399 (GRCm39) L153H probably damaging Het
Pjvk T C 2: 76,481,750 (GRCm39) S68P probably damaging Het
Pkd1 T C 17: 24,804,666 (GRCm39) V3130A probably damaging Het
Plpp4 C A 7: 128,858,813 (GRCm39) probably benign Het
Plxnd1 T A 6: 115,970,937 (GRCm39) H277L probably damaging Het
Pramel26 A T 4: 143,538,143 (GRCm39) V276E possibly damaging Het
Rd3l C A 12: 111,946,092 (GRCm39) S63I possibly damaging Het
Scfd2 G C 5: 74,558,368 (GRCm39) A503G possibly damaging Het
Slco4a1 T C 2: 180,114,455 (GRCm39) V549A probably benign Het
Tenm4 A G 7: 96,545,022 (GRCm39) N2375S probably benign Het
Tespa1 C T 10: 130,197,826 (GRCm39) R283C probably damaging Het
Tle2 A G 10: 81,417,516 (GRCm39) E227G possibly damaging Het
Tnn T G 1: 159,943,650 (GRCm39) E1054D probably benign Het
Tnrc6a A T 7: 122,751,405 (GRCm39) K54* probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpr T A 1: 150,279,712 (GRCm39) D206E probably benign Het
Ugt2b34 A T 5: 87,040,726 (GRCm39) F399I probably damaging Het
Usp3 A T 9: 66,425,776 (GRCm39) D456E probably benign Het
Vmn1r60 T A 7: 5,547,488 (GRCm39) H204L probably damaging Het
Vmn2r97 G T 17: 19,150,616 (GRCm39) A488S probably benign Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wdr86 T C 5: 24,935,235 (GRCm39) D36G probably damaging Het
Zc3h4 C T 7: 16,163,036 (GRCm39) P479S unknown Het
Zfhx4 A T 3: 5,279,875 (GRCm39) probably benign Het
Zfp607b T A 7: 27,402,149 (GRCm39) C202S probably damaging Het
Zfp882 T A 8: 72,667,453 (GRCm39) F93L probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 92,033,773 (GRCm39) nonsense probably null
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92,267,941 (GRCm39) missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92,267,954 (GRCm39) missense probably benign
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92,167,361 (GRCm39) missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92,165,027 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92,159,100 (GRCm39) intron probably benign
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 92,136,085 (GRCm39) missense
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATGTCTGAGAGCTTTGCCAG -3'
(R):5'- AGAATGTCCTGGTGGTACATG -3'

Sequencing Primer
(F):5'- TTTGCCAGCACTACGGTG -3'
(R):5'- CCTGGTGGTACATGGTGTCCC -3'
Posted On 2015-07-21