Incidental Mutation 'R4440:Cfc1'
ID 329699
Institutional Source Beutler Lab
Gene Symbol Cfc1
Ensembl Gene ENSMUSG00000026124
Gene Name cripto, FRL-1, cryptic family 1
Synonyms cryptic, b2b970Clo
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 34535648-34544313 bp(+) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to A at 34544102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027298] [ENSMUST00000115071]
AlphaFold P97766
Predicted Effect unknown
Transcript: ENSMUST00000027298
AA Change: C192S
SMART Domains Protein: ENSMUSP00000027298
Gene: ENSMUSG00000026124
AA Change: C192S

DomainStartEndE-ValueType
Blast:EGF 74 123 2e-11 BLAST
SCOP:d1autl1 99 125 2e-5 SMART
Pfam:CFC 131 165 4.7e-17 PFAM
low complexity region 186 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115071
SMART Domains Protein: ENSMUSP00000110723
Gene: ENSMUSG00000037529

DomainStartEndE-ValueType
Tryp_SPc 1 146 8.36e-5 SMART
Meta Mutation Damage Score 0.1167 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype PHENOTYPE: Targeted null mutations of this gene result in left-right laterality defects, including randomization of abdominal situs, asplenia or severe hyposplenia, pulmonary right isomerism, randomized embryo turning and cardiac looping, and postnatal death due tocomplex cardiac malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Cfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Cfc1 APN 1 34537122 splice site probably benign
R0414:Cfc1 UTSW 1 34537328 missense probably damaging 0.97
R0522:Cfc1 UTSW 1 34537153 missense probably damaging 1.00
R1620:Cfc1 UTSW 1 34536473 missense possibly damaging 0.87
R1739:Cfc1 UTSW 1 34537234 missense probably damaging 1.00
R3417:Cfc1 UTSW 1 34536376 nonsense probably null
R5172:Cfc1 UTSW 1 34535930 missense probably benign 0.00
R7139:Cfc1 UTSW 1 34536479 missense probably benign 0.00
R9332:Cfc1 UTSW 1 34537372 missense probably damaging 1.00
R9618:Cfc1 UTSW 1 34536479 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCAGAAGACGGCTTTAG -3'
(R):5'- CAAGGAGGGCTGACCATTAAGC -3'

Sequencing Primer
(F):5'- CGGCTTTAGAGAGAATAACTACAGAC -3'
(R):5'- GCATGAGAATCCAGCATATTCCAGTG -3'
Posted On 2015-07-21