Incidental Mutation 'R4440:Hdac4'
ID329700
Institutional Source Beutler Lab
Gene Symbol Hdac4
Ensembl Gene ENSMUSG00000026313
Gene Namehistone deacetylase 4
Synonyms4932408F19Rik
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4440 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91928779-92195699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91945995 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 957 (G957C)
Ref Sequence ENSEMBL: ENSMUSP00000095249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008995] [ENSMUST00000097644]
Predicted Effect probably damaging
Transcript: ENSMUST00000008995
AA Change: G957C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008995
Gene: ENSMUSG00000026313
AA Change: G957C

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 61 151 5e-38 PFAM
low complexity region 289 310 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
low complexity region 472 502 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
Pfam:Hist_deacetyl 661 985 1.4e-85 PFAM
low complexity region 1066 1075 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097644
AA Change: G957C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189303
Meta Mutation Damage Score 0.4072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased thermal nociception threshold and seizures. Mice homozygous for a knock-out allele exhibit postnatal lethality, exencephaly, and abnormal skeleton morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Hdac4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hdac4 APN 1 91959415 missense probably damaging 0.99
IGL01396:Hdac4 APN 1 91959474 splice site probably benign
IGL01536:Hdac4 APN 1 91930146 utr 3 prime probably benign
IGL01860:Hdac4 APN 1 91933695 missense probably benign 0.31
IGL02110:Hdac4 APN 1 91984405 missense probably benign 0.00
IGL02201:Hdac4 APN 1 91987660 splice site probably null
IGL02294:Hdac4 APN 1 91982207 missense probably benign
IGL02367:Hdac4 APN 1 91958449 splice site probably benign
IGL02429:Hdac4 APN 1 92012695 missense probably benign 0.00
IGL02966:Hdac4 APN 1 92054945 missense possibly damaging 0.94
IGL03250:Hdac4 APN 1 91934600 critical splice donor site probably null
R0067:Hdac4 UTSW 1 92029984 missense probably damaging 1.00
R0103:Hdac4 UTSW 1 91975644 missense possibly damaging 0.73
R0288:Hdac4 UTSW 1 91971006 missense probably damaging 1.00
R0334:Hdac4 UTSW 1 91956038 splice site probably benign
R1473:Hdac4 UTSW 1 92029968 missense possibly damaging 0.88
R1732:Hdac4 UTSW 1 91947535 missense probably benign 0.01
R1826:Hdac4 UTSW 1 91984699 missense probably damaging 1.00
R1987:Hdac4 UTSW 1 91934645 missense probably damaging 1.00
R2189:Hdac4 UTSW 1 91975522 missense probably null 0.00
R2384:Hdac4 UTSW 1 91984485 missense probably benign 0.02
R3705:Hdac4 UTSW 1 91934694 splice site probably benign
R3894:Hdac4 UTSW 1 91970968 missense possibly damaging 0.95
R5075:Hdac4 UTSW 1 91996120 missense probably benign 0.00
R5431:Hdac4 UTSW 1 91972790 nonsense probably null
R5505:Hdac4 UTSW 1 91975465 missense probably benign
R5854:Hdac4 UTSW 1 91959421 missense probably damaging 1.00
R6018:Hdac4 UTSW 1 91958398 missense probably damaging 1.00
R6164:Hdac4 UTSW 1 92030154 missense probably benign 0.04
R6239:Hdac4 UTSW 1 92054972 missense probably benign 0.17
R6247:Hdac4 UTSW 1 92012838 intron probably null
R6306:Hdac4 UTSW 1 91996174 missense probably benign 0.00
R6381:Hdac4 UTSW 1 91984525 missense possibly damaging 0.67
R6450:Hdac4 UTSW 1 91984711 missense possibly damaging 0.81
R6504:Hdac4 UTSW 1 91968455 missense possibly damaging 0.88
R6639:Hdac4 UTSW 1 91970948 missense probably damaging 1.00
R6799:Hdac4 UTSW 1 92002213 missense probably damaging 0.98
R6910:Hdac4 UTSW 1 91982153 missense probably damaging 1.00
R7002:Hdac4 UTSW 1 91968361 missense possibly damaging 0.85
R7781:Hdac4 UTSW 1 91975665 missense probably benign 0.41
R8156:Hdac4 UTSW 1 91958416 missense probably damaging 0.99
Z1177:Hdac4 UTSW 1 91956047 missense probably damaging 1.00
Z1177:Hdac4 UTSW 1 91987611 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCAAGGTCAGACATCCTAC -3'
(R):5'- TCGGATGAAGATACAATCCAAAAGC -3'

Sequencing Primer
(F):5'- ATACAGCTGTAGCCCCGTG -3'
(R):5'- GCCAAACTAATAAGCATGTTAAGCG -3'
Posted On2015-07-21