Incidental Mutation 'R4440:Olfr1212'
ID329704
Institutional Source Beutler Lab
Gene Symbol Olfr1212
Ensembl Gene ENSMUSG00000048226
Gene Nameolfactory receptor 1212
SynonymsGA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4440 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88953969-88961313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88959341 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 292 (E292K)
Ref Sequence ENSEMBL: ENSMUSP00000149781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055895] [ENSMUST00000215781]
Predicted Effect probably benign
Transcript: ENSMUST00000055895
AA Change: E292K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052837
Gene: ENSMUSG00000048226
AA Change: E292K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-46 PFAM
Pfam:7tm_1 39 286 7.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215781
AA Change: E292K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.3411 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 A G 7: 49,575,263 probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Olfr1212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1212 APN 2 88958766 missense probably damaging 0.98
IGL01398:Olfr1212 APN 2 88958849 missense probably damaging 1.00
IGL01537:Olfr1212 APN 2 88958541 missense probably benign 0.00
IGL02197:Olfr1212 APN 2 88958684 missense probably benign 0.05
IGL02557:Olfr1212 APN 2 88958681 missense probably benign 0.00
R0276:Olfr1212 UTSW 2 88958755 nonsense probably null
R0568:Olfr1212 UTSW 2 88959043 nonsense probably null
R0699:Olfr1212 UTSW 2 88958616 missense probably benign 0.31
R1101:Olfr1212 UTSW 2 88958984 missense possibly damaging 0.60
R1205:Olfr1212 UTSW 2 88958588 missense probably benign 0.00
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1845:Olfr1212 UTSW 2 88958867 missense probably damaging 0.99
R2031:Olfr1212 UTSW 2 88959299 missense probably benign 0.19
R2418:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R2419:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R3781:Olfr1212 UTSW 2 88958747 nonsense probably null
R4049:Olfr1212 UTSW 2 88959273 missense probably benign 0.09
R4583:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4646:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4648:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4674:Olfr1212 UTSW 2 88958872 missense probably damaging 0.98
R4851:Olfr1212 UTSW 2 88958586 missense probably damaging 1.00
R4971:Olfr1212 UTSW 2 88958519 missense probably damaging 1.00
R5610:Olfr1212 UTSW 2 88958826 missense probably damaging 1.00
R5805:Olfr1212 UTSW 2 88958641 missense possibly damaging 0.50
R5887:Olfr1212 UTSW 2 88958754 missense possibly damaging 0.60
R6023:Olfr1212 UTSW 2 88958715 missense possibly damaging 0.76
R6118:Olfr1212 UTSW 2 88959118 nonsense probably null
R7490:Olfr1212 UTSW 2 88959048 missense probably benign 0.00
R7542:Olfr1212 UTSW 2 88958775 missense probably benign 0.01
R7612:Olfr1212 UTSW 2 88958505 missense probably damaging 1.00
R7972:Olfr1212 UTSW 2 88958833 nonsense probably null
R8422:Olfr1212 UTSW 2 88958997 missense probably benign 0.05
Z1177:Olfr1212 UTSW 2 88959377 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCACAGTTCTGAAGGGC -3'
(R):5'- TTACAGTGTAATTGTTATTCCCCAG -3'

Sequencing Primer
(F):5'- GCGATGGAAAGCTCTCTCTAC -3'
(R):5'- CCCCAGTTAAAGACAATTTTTCGGTC -3'
Posted On2015-07-21