Incidental Mutation 'R4440:Ndufaf5'
ID329706
Institutional Source Beutler Lab
Gene Symbol Ndufaf5
Ensembl Gene ENSMUSG00000027384
Gene NameNADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Synonyms
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R4440 (G1)
Quality Score214
Status Validated
Chromosome2
Chromosomal Location140170649-140203689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140170725 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 5 (V5D)
Ref Sequence ENSEMBL: ENSMUSP00000035325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044825] [ENSMUST00000046030]
Predicted Effect probably benign
Transcript: ENSMUST00000044825
AA Change: V5D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035325
Gene: ENSMUSG00000027384
AA Change: V5D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Methyltransf_29 45 196 7.1e-8 PFAM
Pfam:Methyltransf_23 53 239 6.4e-16 PFAM
Pfam:Ubie_methyltran 78 204 3e-10 PFAM
Pfam:Methyltransf_18 89 187 1.1e-8 PFAM
Pfam:Methyltransf_31 92 243 9.6e-13 PFAM
Pfam:Methyltransf_25 93 182 1.3e-9 PFAM
Pfam:Methyltransf_12 94 184 2.4e-14 PFAM
Pfam:Methyltransf_11 94 186 6.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046030
SMART Domains Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624

DomainStartEndE-ValueType
coiled coil region 91 114 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 230 258 N/A INTRINSIC
coiled coil region 261 293 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
coiled coil region 628 652 N/A INTRINSIC
low complexity region 667 692 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
Pfam:NUC153 753 781 4.1e-15 PFAM
low complexity region 784 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125913
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Ndufaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Ndufaf5 APN 2 140188743 missense probably benign 0.01
R0373:Ndufaf5 UTSW 2 140170881 missense probably benign 0.03
R1654:Ndufaf5 UTSW 2 140177300 splice site probably null
R1710:Ndufaf5 UTSW 2 140193602 missense possibly damaging 0.92
R1868:Ndufaf5 UTSW 2 140181589 missense probably benign 0.00
R2226:Ndufaf5 UTSW 2 140188860 missense probably benign 0.02
R3794:Ndufaf5 UTSW 2 140202923 missense possibly damaging 0.89
R4621:Ndufaf5 UTSW 2 140183925 missense probably benign 0.02
R4669:Ndufaf5 UTSW 2 140187755 missense probably benign 0.11
R5683:Ndufaf5 UTSW 2 140202923 missense possibly damaging 0.89
R6904:Ndufaf5 UTSW 2 140188780 nonsense probably null
R6937:Ndufaf5 UTSW 2 140181602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGCTACTCACAAATCCC -3'
(R):5'- CAAATTTCATGGGGTCGGGC -3'

Sequencing Primer
(F):5'- ATCCCAGTCTGAGTTCACATGGAG -3'
(R):5'- GTCGAAGATGTTTAGGGC -3'
Posted On2015-07-21