Incidental Mutation 'R4440:Adnp'
ID 329709
Institutional Source Beutler Lab
Gene Symbol Adnp
Ensembl Gene ENSMUSG00000051149
Gene Name activity-dependent neuroprotective protein
Synonyms mKIAA0784
MMRRC Submission 041705-MU
Accession Numbers

Genbank: NM_009628; MGI: 1338758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 168180986-168207112 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 168184801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 191 (H191Q)
Ref Sequence ENSEMBL: ENSMUSP00000085316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]
AlphaFold Q9Z103
Predicted Effect possibly damaging
Transcript: ENSMUST00000057793
AA Change: H191Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: H191Q

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088001
AA Change: H191Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: H191Q

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139984
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 A G 7: 49,575,263 probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Adnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adnp APN 2 168182562 missense probably benign
IGL00500:Adnp APN 2 168183323 missense possibly damaging 0.85
IGL01604:Adnp APN 2 168184338 missense probably damaging 0.99
IGL01967:Adnp APN 2 168183419 missense possibly damaging 0.85
IGL02470:Adnp APN 2 168183194 missense probably damaging 0.99
C9142:Adnp UTSW 2 168184407 missense probably damaging 0.99
R0893:Adnp UTSW 2 168183727 missense possibly damaging 0.85
R1167:Adnp UTSW 2 168184500 missense probably benign 0.11
R1182:Adnp UTSW 2 168184796 missense possibly damaging 0.77
R1480:Adnp UTSW 2 168183534 missense probably damaging 0.99
R1505:Adnp UTSW 2 168183741 missense possibly damaging 0.93
R1906:Adnp UTSW 2 168182367 missense probably benign
R3711:Adnp UTSW 2 168184823 missense probably damaging 0.98
R3943:Adnp UTSW 2 168185060 missense possibly damaging 0.92
R4686:Adnp UTSW 2 168182389 missense possibly damaging 0.78
R4916:Adnp UTSW 2 168187617 missense possibly damaging 0.91
R5072:Adnp UTSW 2 168183001 missense probably damaging 0.96
R5312:Adnp UTSW 2 168184188 missense probably benign
R5393:Adnp UTSW 2 168182949 missense possibly damaging 0.95
R5598:Adnp UTSW 2 168183725 missense probably damaging 0.99
R6230:Adnp UTSW 2 168182532 missense probably benign
R7165:Adnp UTSW 2 168182367 missense probably benign 0.07
R7176:Adnp UTSW 2 168182658 missense probably benign
R7238:Adnp UTSW 2 168183967 missense probably damaging 1.00
R7254:Adnp UTSW 2 168183998 missense probably damaging 0.99
R7581:Adnp UTSW 2 168183466 missense probably damaging 0.96
R7676:Adnp UTSW 2 168183447 nonsense probably null
R7863:Adnp UTSW 2 168189350 missense possibly damaging 0.91
R8098:Adnp UTSW 2 168182532 missense probably benign
R8196:Adnp UTSW 2 168183172 missense probably benign
R8970:Adnp UTSW 2 168189370 missense possibly damaging 0.91
R9153:Adnp UTSW 2 168184660 missense possibly damaging 0.96
R9154:Adnp UTSW 2 168184660 missense possibly damaging 0.96
R9228:Adnp UTSW 2 168184878 missense probably damaging 0.98
R9256:Adnp UTSW 2 168184025 missense probably damaging 1.00
R9268:Adnp UTSW 2 168189313 missense possibly damaging 0.86
R9434:Adnp UTSW 2 168184457 missense probably damaging 0.99
R9517:Adnp UTSW 2 168182946 missense possibly damaging 0.93
R9621:Adnp UTSW 2 168182743 missense probably benign 0.22
R9669:Adnp UTSW 2 168184998 missense possibly damaging 0.91
R9737:Adnp UTSW 2 168184998 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTACAACATTTGTGTGTCCGATC -3'
(R):5'- TTCATGCTCCAAACTCCAGC -3'

Sequencing Primer
(F):5'- ATGGCAGTGACCTGATAGCCTATC -3'
(R):5'- GCGCACCAAGTAGCAGC -3'
Posted On 2015-07-21