Incidental Mutation 'R4440:Dpysl5'
ID 329714
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Name dihydropyrimidinase-like 5
Synonyms CRMP-5, Crmp5, CRAM
MMRRC Submission 041705-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.234) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 30868908-30956713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30949612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 461 (F461L)
Ref Sequence ENSEMBL: ENSMUSP00000110377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
AlphaFold Q9EQF6
Predicted Effect probably damaging
Transcript: ENSMUST00000088081
AA Change: F461L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: F461L

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114729
AA Change: F461L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: F461L

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198503
Meta Mutation Damage Score 0.5813 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,026,721 (GRCm39) H191Q possibly damaging Het
Afdn T C 17: 14,071,152 (GRCm39) W782R probably damaging Het
Alpl A T 4: 137,475,124 (GRCm39) W270R probably damaging Het
Angpt4 G T 2: 151,786,566 (GRCm39) G508C probably damaging Het
Armc8 T A 9: 99,366,087 (GRCm39) H609L probably benign Het
Atg2a T C 19: 6,305,859 (GRCm39) probably null Het
Bicdl2 C T 17: 23,886,590 (GRCm39) A393V probably benign Het
C6 A T 15: 4,764,733 (GRCm39) K143M possibly damaging Het
Cfc1 T A 1: 34,583,183 (GRCm39) probably benign Het
Ctnna3 A G 10: 64,096,714 (GRCm39) I417M probably benign Het
Dnhd1 G A 7: 105,345,935 (GRCm39) W2307* probably null Het
Fip1l1 T C 5: 74,697,446 (GRCm39) probably benign Het
Fpgs C T 2: 32,577,513 (GRCm39) C219Y probably damaging Het
Fsip2 A G 2: 82,821,550 (GRCm39) D5761G possibly damaging Het
Hdac4 C A 1: 91,873,717 (GRCm39) G957C probably damaging Het
Klhl8 A G 5: 104,015,433 (GRCm39) I421T probably benign Het
Kntc1 T C 5: 123,932,216 (GRCm39) C1337R probably damaging Het
Lpin3 A G 2: 160,740,565 (GRCm39) N370S probably benign Het
Man2a2 C A 7: 80,001,463 (GRCm39) R1148L probably benign Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Nav2 C T 7: 49,201,785 (GRCm39) T1453I possibly damaging Het
Nav2 A G 7: 49,225,011 (GRCm39) probably benign Het
Ndufaf5 T A 2: 140,012,645 (GRCm39) V5D probably benign Het
Nipbl G C 15: 8,396,142 (GRCm39) Q144E probably damaging Het
Ntrk2 G C 13: 59,208,126 (GRCm39) Q657H probably damaging Het
Or4a75 G T 2: 89,448,512 (GRCm39) T8K probably damaging Het
Or4c107 G A 2: 88,789,685 (GRCm39) E292K probably benign Het
Polr1a A G 6: 71,927,832 (GRCm39) D861G probably damaging Het
Pramel15 A T 4: 144,099,437 (GRCm39) F443I probably benign Het
Pwwp2b T C 7: 138,835,555 (GRCm39) I332T probably benign Het
Rasgrf2 T C 13: 92,131,797 (GRCm39) D620G possibly damaging Het
Slc14a2 A G 18: 78,238,962 (GRCm39) V219A probably benign Het
Slc7a2 T C 8: 41,355,686 (GRCm39) I245T probably benign Het
Smok3c T A 5: 138,062,866 (GRCm39) Y118N possibly damaging Het
Taok2 C T 7: 126,465,693 (GRCm39) R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,254,752 (GRCm39) probably null Het
Tbr1 A T 2: 61,635,182 (GRCm39) D44V possibly damaging Het
Tespa1 C T 10: 130,197,826 (GRCm39) R283C probably damaging Het
Tle2 A G 10: 81,417,516 (GRCm39) E227G possibly damaging Het
Vmn1r231 T C 17: 21,110,718 (GRCm39) R66G possibly damaging Het
Xab2 T C 8: 3,666,353 (GRCm39) E185G probably benign Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30,902,622 (GRCm39) missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30,946,125 (GRCm39) missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30,935,410 (GRCm39) missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30,946,185 (GRCm39) critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30,935,338 (GRCm39) missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R4863:Dpysl5 UTSW 5 30,941,687 (GRCm39) missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30,948,857 (GRCm39) missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30,935,317 (GRCm39) critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30,941,813 (GRCm39) critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30,940,539 (GRCm39) missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30,949,642 (GRCm39) missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30,902,805 (GRCm39) missense probably benign
R7446:Dpysl5 UTSW 5 30,936,231 (GRCm39) missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30,902,760 (GRCm39) missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30,953,658 (GRCm39) missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30,902,811 (GRCm39) missense probably damaging 0.99
R8835:Dpysl5 UTSW 5 30,936,282 (GRCm39) critical splice donor site probably null
R8888:Dpysl5 UTSW 5 30,902,687 (GRCm39) missense probably benign 0.01
R8943:Dpysl5 UTSW 5 30,935,375 (GRCm39) missense probably benign 0.33
R9033:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R9139:Dpysl5 UTSW 5 30,935,397 (GRCm39) missense probably benign 0.45
R9305:Dpysl5 UTSW 5 30,948,959 (GRCm39) missense probably damaging 1.00
R9522:Dpysl5 UTSW 5 30,935,399 (GRCm39) nonsense probably null
R9700:Dpysl5 UTSW 5 30,904,417 (GRCm39) nonsense probably null
Z1176:Dpysl5 UTSW 5 30,935,464 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAAGCTCTTGTTCCACCC -3'
(R):5'- TGAAACTTTTCCCCTTCTGAGG -3'

Sequencing Primer
(F):5'- AGAAGCTCTTGTTCCACCCTCATTC -3'
(R):5'- CCTTCTGAGGTATCCTGGTCAATTG -3'
Posted On 2015-07-21