Incidental Mutation 'R4440:Fip1l1'
ID 329715
Institutional Source Beutler Lab
Gene Symbol Fip1l1
Ensembl Gene ENSMUSG00000029227
Gene Name FIP1 like 1 (S. cerevisiae)
Synonyms 1300019H17Rik, Rje
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 74535449-74598800 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 74536785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080164] [ENSMUST00000113534] [ENSMUST00000113535] [ENSMUST00000113536] [ENSMUST00000120618]
AlphaFold Q9D824
Predicted Effect probably benign
Transcript: ENSMUST00000080164
SMART Domains Protein: ENSMUSP00000079059
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.2e-28 PFAM
low complexity region 296 357 N/A INTRINSIC
low complexity region 405 441 N/A INTRINSIC
low complexity region 453 507 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113534
SMART Domains Protein: ENSMUSP00000109162
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.1e-28 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113535
SMART Domains Protein: ENSMUSP00000109163
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 6.4e-29 PFAM
low complexity region 296 346 N/A INTRINSIC
low complexity region 396 432 N/A INTRINSIC
low complexity region 444 498 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113536
SMART Domains Protein: ENSMUSP00000109164
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 152 196 1.3e-28 PFAM
low complexity region 247 267 N/A INTRINSIC
low complexity region 332 393 N/A INTRINSIC
low complexity region 441 477 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
low complexity region 546 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120618
SMART Domains Protein: ENSMUSP00000113995
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Pfam:Fip1 137 181 2e-29 PFAM
low complexity region 255 275 N/A INTRINSIC
low complexity region 340 401 N/A INTRINSIC
low complexity region 449 485 N/A INTRINSIC
low complexity region 497 551 N/A INTRINSIC
low complexity region 554 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121950
SMART Domains Protein: ENSMUSP00000113611
Gene: ENSMUSG00000029227

DomainStartEndE-ValueType
low complexity region 44 53 N/A INTRINSIC
low complexity region 78 94 N/A INTRINSIC
Pfam:Fip1 153 195 6.6e-29 PFAM
low complexity region 270 290 N/A INTRINSIC
low complexity region 355 405 N/A INTRINSIC
low complexity region 455 491 N/A INTRINSIC
low complexity region 503 557 N/A INTRINSIC
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200979
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Fip1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Fip1l1 APN 5 74587065 splice site probably benign
IGL02008:Fip1l1 APN 5 74545423 missense possibly damaging 0.80
IGL02069:Fip1l1 APN 5 74591873 missense probably damaging 1.00
IGL02406:Fip1l1 APN 5 74564544 missense probably benign 0.01
IGL02514:Fip1l1 APN 5 74571152 missense probably damaging 1.00
IGL03139:Fip1l1 APN 5 74571115 missense possibly damaging 0.84
R0031:Fip1l1 UTSW 5 74557109 missense probably damaging 1.00
R0325:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0600:Fip1l1 UTSW 5 74595842 missense probably damaging 1.00
R0834:Fip1l1 UTSW 5 74595060 unclassified probably benign
R1183:Fip1l1 UTSW 5 74595102 missense probably damaging 1.00
R1328:Fip1l1 UTSW 5 74546135 missense possibly damaging 0.94
R2434:Fip1l1 UTSW 5 74546824 missense possibly damaging 0.81
R4120:Fip1l1 UTSW 5 74588191 missense probably damaging 1.00
R4197:Fip1l1 UTSW 5 74535736 missense probably damaging 1.00
R4825:Fip1l1 UTSW 5 74588205 splice site probably null
R4838:Fip1l1 UTSW 5 74591939 missense probably damaging 1.00
R5800:Fip1l1 UTSW 5 74546081 missense possibly damaging 0.77
R6159:Fip1l1 UTSW 5 74591947 missense probably damaging 1.00
R6556:Fip1l1 UTSW 5 74547177 critical splice donor site probably null
R6724:Fip1l1 UTSW 5 74591774 missense probably damaging 0.99
R6984:Fip1l1 UTSW 5 74542073 missense probably damaging 0.99
R7092:Fip1l1 UTSW 5 74536843 missense probably damaging 0.98
R7205:Fip1l1 UTSW 5 74588075 splice site probably null
R7325:Fip1l1 UTSW 5 74536799 critical splice acceptor site probably null
R7590:Fip1l1 UTSW 5 74591774 missense probably benign 0.41
R8182:Fip1l1 UTSW 5 74588152 missense probably damaging 0.99
R8826:Fip1l1 UTSW 5 74564527 missense probably benign 0.01
R8905:Fip1l1 UTSW 5 74595963 missense probably damaging 0.99
R8950:Fip1l1 UTSW 5 74595863 missense probably damaging 1.00
R9154:Fip1l1 UTSW 5 74587042 missense possibly damaging 0.95
R9372:Fip1l1 UTSW 5 74546802 missense possibly damaging 0.64
R9473:Fip1l1 UTSW 5 74585058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTTTTAGTAATGAAACTCCG -3'
(R):5'- CATCAACAGGAGAGAGTTCACC -3'

Sequencing Primer
(F):5'- GCATCGGTACTACCCTTAA -3'
(R):5'- GAGAGTTCACCAACCTGGCATTTTC -3'
Posted On 2015-07-21