Incidental Mutation 'R4440:Klhl8'
ID 329716
Institutional Source Beutler Lab
Gene Symbol Klhl8
Ensembl Gene ENSMUSG00000029312
Gene Name kelch-like 8
Synonyms D5Ertd431e, 2310001P09Rik
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 103861973-103911259 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103867567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 421 (I421T)
Ref Sequence ENSEMBL: ENSMUSP00000108434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031254] [ENSMUST00000112811] [ENSMUST00000112815] [ENSMUST00000131843]
AlphaFold P59280
Predicted Effect probably benign
Transcript: ENSMUST00000031254
AA Change: I497T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031254
Gene: ENSMUSG00000029312
AA Change: I497T

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
BTB 76 173 1.14e-24 SMART
BACK 178 280 7.17e-30 SMART
Kelch 328 375 4.01e-8 SMART
Kelch 376 422 2.52e-14 SMART
Kelch 423 469 3.23e-12 SMART
Kelch 470 516 1.03e-10 SMART
Kelch 517 563 1.66e-14 SMART
Kelch 564 610 6.12e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112811
AA Change: I314T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108430
Gene: ENSMUSG00000029312
AA Change: I314T

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Kelch 145 192 4.01e-8 SMART
Kelch 193 239 2.52e-14 SMART
Kelch 240 286 3.23e-12 SMART
Kelch 287 333 1.03e-10 SMART
Kelch 334 380 1.66e-14 SMART
Kelch 381 427 6.12e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112815
AA Change: I421T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108434
Gene: ENSMUSG00000029312
AA Change: I421T

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
BACK 102 204 7.17e-30 SMART
Kelch 252 299 4.01e-8 SMART
Kelch 300 346 2.52e-14 SMART
Kelch 347 393 3.23e-12 SMART
Kelch 394 440 1.03e-10 SMART
Kelch 441 487 1.66e-14 SMART
Kelch 488 534 6.12e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131843
SMART Domains Protein: ENSMUSP00000117671
Gene: ENSMUSG00000029312

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147184
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Klhl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Klhl8 UTSW 5 103867938 missense probably benign 0.45
R0718:Klhl8 UTSW 5 103876293 intron probably benign
R1374:Klhl8 UTSW 5 103863183 missense probably damaging 1.00
R1662:Klhl8 UTSW 5 103872045 missense probably damaging 0.96
R6406:Klhl8 UTSW 5 103863115 missense possibly damaging 0.87
R6961:Klhl8 UTSW 5 103870569 missense possibly damaging 0.92
R7807:Klhl8 UTSW 5 103876066 missense probably damaging 1.00
R7863:Klhl8 UTSW 5 103872102 missense probably benign
R8217:Klhl8 UTSW 5 103867600 missense possibly damaging 0.51
R8240:Klhl8 UTSW 5 103867526 missense probably damaging 0.97
R8241:Klhl8 UTSW 5 103867526 missense probably damaging 0.97
R8278:Klhl8 UTSW 5 103874241 missense probably benign 0.00
R8297:Klhl8 UTSW 5 103863088 missense probably benign 0.23
R8504:Klhl8 UTSW 5 103867948 missense probably benign 0.30
R8539:Klhl8 UTSW 5 103867526 missense probably damaging 0.97
R8991:Klhl8 UTSW 5 103870538 missense probably benign 0.03
R9051:Klhl8 UTSW 5 103867843 critical splice donor site probably null
R9176:Klhl8 UTSW 5 103864245 missense probably benign 0.00
R9183:Klhl8 UTSW 5 103864245 missense probably benign 0.00
Z1177:Klhl8 UTSW 5 103886039 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACATCTCAGGACTGATCC -3'
(R):5'- AGCCGCAGCATTGATTACC -3'

Sequencing Primer
(F):5'- GGACTGATCCACTAAAGGTTGAC -3'
(R):5'- GCAGCATTGATTACCTACCAAAGTG -3'
Posted On 2015-07-21