Incidental Mutation 'R0047:Kif9'
ID 32972
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
MMRRC Submission 038341-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R0047 (G1)
Quality Score 198
Status Validated (trace)
Chromosome 9
Chromosomal Location 110306062-110354242 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110314106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 33 (I33V)
Ref Sequence ENSEMBL: ENSMUSP00000142689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043] [ENSMUST00000198858]
AlphaFold Q9WV04
Predicted Effect probably benign
Transcript: ENSMUST00000061155
AA Change: I33V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: I33V

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084952
AA Change: I33V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: I33V

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197248
AA Change: I33V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: I33V

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
AA Change: I33V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489
AA Change: I33V

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198858
AA Change: I39V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142888
Gene: ENSMUSG00000032489
AA Change: I39V

DomainStartEndE-ValueType
KISc 9 144 6.7e-7 SMART
Meta Mutation Damage Score 0.1321 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,772,025 (GRCm39) T405A probably damaging Het
Acer1 A T 17: 57,262,624 (GRCm39) D175E possibly damaging Het
Acsf2 T C 11: 94,460,168 (GRCm39) I395V probably benign Het
Adamts9 G A 6: 92,882,287 (GRCm39) probably benign Het
Amigo3 T C 9: 107,931,857 (GRCm39) S427P probably benign Het
Ankrd35 A G 3: 96,591,379 (GRCm39) K555R probably benign Het
Arhgap35 A T 7: 16,295,917 (GRCm39) H1049Q probably benign Het
Arhgef5 G A 6: 43,242,555 (GRCm39) probably null Het
Arid4a T G 12: 71,122,193 (GRCm39) L858W probably damaging Het
Bbox1 A G 2: 110,098,647 (GRCm39) F310S probably damaging Het
Bhlhe22 T C 3: 18,109,733 (GRCm39) L261P probably damaging Het
Bltp1 T A 3: 36,962,341 (GRCm39) L481M possibly damaging Het
Bmper T A 9: 23,317,982 (GRCm39) C534S probably damaging Het
Cacna1d T G 14: 30,068,747 (GRCm39) probably benign Het
Camk2g G A 14: 20,821,136 (GRCm39) probably benign Het
Capn12 G A 7: 28,589,812 (GRCm39) probably null Het
Cdkl4 T G 17: 80,858,274 (GRCm39) N115T probably benign Het
Chchd1 T C 14: 20,754,231 (GRCm39) S48P possibly damaging Het
Chia1 G T 3: 106,022,573 (GRCm39) C49F probably damaging Het
Cnot7 A G 8: 40,948,962 (GRCm39) probably benign Het
Crh T C 3: 19,748,201 (GRCm39) E147G probably damaging Het
Cux1 T C 5: 136,392,107 (GRCm39) probably benign Het
Cyp2b19 T A 7: 26,466,251 (GRCm39) D351E probably benign Het
Dctn1 G T 6: 83,159,614 (GRCm39) G31* probably null Het
Duox1 T A 2: 122,177,122 (GRCm39) probably benign Het
Egflam T G 15: 7,282,911 (GRCm39) E382A possibly damaging Het
Ext1 T C 15: 53,208,542 (GRCm39) N73S probably benign Het
Ffar4 A G 19: 38,102,452 (GRCm39) probably benign Het
Glg1 A T 8: 111,892,214 (GRCm39) M866K probably damaging Het
Golm1 T A 13: 59,792,914 (GRCm39) H197L probably benign Het
Gtse1 A G 15: 85,746,579 (GRCm39) K132E probably damaging Het
Gxylt2 A T 6: 100,710,339 (GRCm39) probably benign Het
Hrc T A 7: 44,986,113 (GRCm39) S421R probably benign Het
Ighg2c T A 12: 113,251,788 (GRCm39) probably benign Het
Ihh A G 1: 74,985,750 (GRCm39) I245T probably benign Het
Ilf3 T A 9: 21,300,010 (GRCm39) M65K possibly damaging Het
Insr A G 8: 3,252,947 (GRCm39) V404A probably damaging Het
Irak2 G T 6: 113,649,914 (GRCm39) probably benign Het
Irak2 G A 6: 113,655,699 (GRCm39) V367I probably benign Het
Kat7 A C 11: 95,191,034 (GRCm39) N119K probably benign Het
Klf17 A G 4: 117,618,229 (GRCm39) Y43H probably benign Het
Kng2 T A 16: 22,806,313 (GRCm39) T629S possibly damaging Het
Lama1 A T 17: 68,102,181 (GRCm39) probably benign Het
Lamb1 T C 12: 31,328,600 (GRCm39) I188T possibly damaging Het
Lpp T A 16: 24,480,550 (GRCm39) probably benign Het
Lrp12 T C 15: 39,741,635 (GRCm39) E360G probably damaging Het
Mark2 A C 19: 7,260,942 (GRCm39) probably benign Het
Mmp3 T C 9: 7,451,910 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,928,727 (GRCm39) probably benign Het
Mtr A T 13: 12,237,112 (GRCm39) S569T probably damaging Het
Myh13 T A 11: 67,258,063 (GRCm39) S1752T probably benign Het
Myo5a T A 9: 75,063,489 (GRCm39) L565H probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nfkb1 A T 3: 135,300,814 (GRCm39) L72* probably null Het
Numa1 A G 7: 101,658,660 (GRCm39) K296E probably damaging Het
Obi1 T A 14: 104,740,780 (GRCm39) probably null Het
Or51ab3 A T 7: 103,201,529 (GRCm39) Y179F probably damaging Het
Or5ac19 C T 16: 59,089,574 (GRCm39) G152D probably damaging Het
Or5b120 A G 19: 13,479,953 (GRCm39) E82G probably benign Het
Or5h18 T A 16: 58,847,587 (GRCm39) M228L probably benign Het
Or5p80 A G 7: 108,229,759 (GRCm39) I187V probably benign Het
Pcdhb5 A T 18: 37,454,321 (GRCm39) I234F possibly damaging Het
Pgm5 T A 19: 24,661,920 (GRCm39) I545F probably damaging Het
Pla2g2c T C 4: 138,470,901 (GRCm39) probably benign Het
Pnpla7 A T 2: 24,901,618 (GRCm39) E548V probably damaging Het
Ppm1m C A 9: 106,073,895 (GRCm39) E273* probably null Het
Ppp2r1b C T 9: 50,772,873 (GRCm39) R117* probably null Het
Rabgap1l G A 1: 160,059,359 (GRCm39) probably benign Het
Rapgef6 T A 11: 54,437,204 (GRCm39) M49K possibly damaging Het
Rhox4f A C X: 36,789,122 (GRCm39) V15G probably benign Het
Rtel1 T G 2: 180,965,198 (GRCm39) I146M probably damaging Het
Sdr9c7 A T 10: 127,739,541 (GRCm39) M219L probably benign Het
Serpina3g T A 12: 104,206,543 (GRCm39) S115T possibly damaging Het
Serpinb1a A T 13: 33,034,259 (GRCm39) L44Q probably damaging Het
Slc13a4 A G 6: 35,264,297 (GRCm39) I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 (GRCm39) L177P probably damaging Het
Slc47a2 C T 11: 61,227,068 (GRCm39) V167M possibly damaging Het
Snrnp200 C T 2: 127,076,874 (GRCm39) probably benign Het
Snx13 C A 12: 35,151,123 (GRCm39) probably benign Het
Snx25 C T 8: 46,494,402 (GRCm39) A828T probably damaging Het
Spic A G 10: 88,511,803 (GRCm39) L151P probably damaging Het
Ssu2 G A 6: 112,351,781 (GRCm39) H315Y probably damaging Het
Stk32a T C 18: 43,446,443 (GRCm39) probably benign Het
Tbx3 A T 5: 119,818,511 (GRCm39) E382V probably damaging Het
Tcaf2 A G 6: 42,606,547 (GRCm39) I469T probably benign Het
Tln2 A G 9: 67,147,954 (GRCm39) probably benign Het
Top2a T A 11: 98,888,682 (GRCm39) I1260L probably benign Het
Treml1 C A 17: 48,672,008 (GRCm39) S91* probably null Het
Trim26 T C 17: 37,168,756 (GRCm39) probably benign Het
Trmt11 T C 10: 30,411,239 (GRCm39) N418S probably benign Het
Ttf1 A G 2: 28,974,667 (GRCm39) Y801C probably damaging Het
Usp34 C T 11: 23,414,403 (GRCm39) A2782V probably benign Het
Vmn2r77 T C 7: 86,460,858 (GRCm39) V728A probably benign Het
Vps4a T C 8: 107,763,333 (GRCm39) L29P probably damaging Het
Wdfy3 A G 5: 102,091,899 (GRCm39) I480T probably damaging Het
Wdr41 A G 13: 95,146,795 (GRCm39) I197V probably damaging Het
Ywhag A T 5: 135,940,153 (GRCm39) V147E probably damaging Het
Zan A G 5: 137,401,918 (GRCm39) M4058T unknown Het
Zfp236 C T 18: 82,698,817 (GRCm39) C88Y probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110,314,138 (GRCm39) missense probably benign 0.03
IGL02273:Kif9 APN 9 110,339,538 (GRCm39) missense probably damaging 0.99
IGL02818:Kif9 APN 9 110,314,217 (GRCm39) missense probably damaging 1.00
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0137:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably damaging 1.00
R0594:Kif9 UTSW 9 110,340,408 (GRCm39) missense probably benign 0.22
R1503:Kif9 UTSW 9 110,339,506 (GRCm39) missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110,319,034 (GRCm39) missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110,346,701 (GRCm39) missense probably benign 0.34
R1856:Kif9 UTSW 9 110,346,787 (GRCm39) missense probably null 1.00
R2076:Kif9 UTSW 9 110,314,100 (GRCm39) splice site probably null
R3407:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R4247:Kif9 UTSW 9 110,325,027 (GRCm39) critical splice donor site probably null
R4487:Kif9 UTSW 9 110,323,552 (GRCm39) missense probably null 1.00
R4515:Kif9 UTSW 9 110,318,935 (GRCm39) missense probably benign 0.38
R4880:Kif9 UTSW 9 110,330,703 (GRCm39) missense probably damaging 0.98
R5024:Kif9 UTSW 9 110,312,161 (GRCm39) missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110,318,965 (GRCm39) missense probably damaging 1.00
R5181:Kif9 UTSW 9 110,350,336 (GRCm39) missense probably damaging 1.00
R5362:Kif9 UTSW 9 110,319,012 (GRCm39) missense probably damaging 0.99
R5379:Kif9 UTSW 9 110,350,371 (GRCm39) missense probably benign 0.00
R5628:Kif9 UTSW 9 110,343,621 (GRCm39) nonsense probably null
R5653:Kif9 UTSW 9 110,353,999 (GRCm39) missense probably damaging 1.00
R5698:Kif9 UTSW 9 110,339,532 (GRCm39) missense probably benign
R5758:Kif9 UTSW 9 110,318,947 (GRCm39) missense probably damaging 1.00
R5986:Kif9 UTSW 9 110,319,094 (GRCm39) missense probably benign 0.05
R6103:Kif9 UTSW 9 110,318,917 (GRCm39) missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110,317,612 (GRCm39) missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110,346,902 (GRCm39) splice site probably null
R6991:Kif9 UTSW 9 110,323,690 (GRCm39) missense probably damaging 1.00
R7113:Kif9 UTSW 9 110,335,732 (GRCm39) missense probably damaging 1.00
R7459:Kif9 UTSW 9 110,348,109 (GRCm39) missense probably damaging 1.00
R7593:Kif9 UTSW 9 110,350,421 (GRCm39) missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110,343,682 (GRCm39) missense not run
R8050:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R8370:Kif9 UTSW 9 110,317,681 (GRCm39) missense probably damaging 1.00
R8549:Kif9 UTSW 9 110,343,487 (GRCm39) splice site probably null
R8751:Kif9 UTSW 9 110,330,724 (GRCm39) missense probably benign 0.03
R8830:Kif9 UTSW 9 110,353,998 (GRCm39) missense probably damaging 1.00
R9489:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9519:Kif9 UTSW 9 110,350,344 (GRCm39) missense probably damaging 0.98
R9605:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9776:Kif9 UTSW 9 110,350,398 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCAGAGGCATCAGTCACACAG -3'
(R):5'- TCAAGGGCTTGAGAAACCGCATC -3'

Sequencing Primer
(F):5'- tgtttgtttgtttgtttgtttgtttg -3'
(R):5'- TTGAGAAACCGCATCCTTGG -3'
Posted On 2013-05-09