Incidental Mutation 'R4440:Tle2'
ID 329730
Institutional Source Beutler Lab
Gene Symbol Tle2
Ensembl Gene ENSMUSG00000034771
Gene Name transducin-like enhancer of split 2
Synonyms Grg2
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 81574561-81590845 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81581682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 227 (E227G)
Ref Sequence ENSEMBL: ENSMUSP00000121125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135211] [ENSMUST00000136341] [ENSMUST00000143285] [ENSMUST00000146358] [ENSMUST00000146916]
AlphaFold Q9WVB2
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000135211
AA Change: E193G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771
AA Change: E193G

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect probably benign
Transcript: ENSMUST00000136341
SMART Domains Protein: ENSMUSP00000121585
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 121 1.3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect probably benign
Transcript: ENSMUST00000143285
SMART Domains Protein: ENSMUSP00000122074
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 78 1.5e-49 PFAM
Pfam:TLE_N 76 114 1.3e-11 PFAM
low complexity region 124 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145878
Predicted Effect possibly damaging
Transcript: ENSMUST00000146358
AA Change: E227G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771
AA Change: E227G

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146916
AA Change: E204G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771
AA Change: E204G

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151470
Meta Mutation Damage Score 0.1294 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Tle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Tle2 APN 10 81581739 missense probably benign 0.12
IGL02651:Tle2 APN 10 81586889 missense probably damaging 1.00
IGL02809:Tle2 APN 10 81586362 splice site probably null
IGL03235:Tle2 APN 10 81586251 missense probably benign 0.22
IGL03307:Tle2 APN 10 81590240 missense probably damaging 1.00
foxbat UTSW 10 81586313 nonsense probably null
Illyushin UTSW 10 81588872 missense probably damaging 1.00
R5011_Tle2_517 UTSW 10 81584697 missense probably damaging 1.00
PIT4515001:Tle2 UTSW 10 81587130 missense possibly damaging 0.72
R0394:Tle2 UTSW 10 81577648 missense probably damaging 1.00
R0744:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R0826:Tle2 UTSW 10 81586314 missense possibly damaging 0.95
R0833:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R1796:Tle2 UTSW 10 81589497 critical splice donor site probably null
R2067:Tle2 UTSW 10 81580551 missense probably damaging 1.00
R2184:Tle2 UTSW 10 81590277 missense probably damaging 1.00
R2198:Tle2 UTSW 10 81590313 missense probably damaging 1.00
R4439:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4441:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4513:Tle2 UTSW 10 81587560 missense probably damaging 1.00
R4839:Tle2 UTSW 10 81577684 missense probably damaging 1.00
R4863:Tle2 UTSW 10 81588891 missense possibly damaging 0.88
R5011:Tle2 UTSW 10 81584697 missense probably damaging 1.00
R5505:Tle2 UTSW 10 81581740 missense probably benign 0.00
R5538:Tle2 UTSW 10 81580584 missense probably damaging 1.00
R5790:Tle2 UTSW 10 81590315 missense probably damaging 1.00
R5917:Tle2 UTSW 10 81580916 critical splice donor site probably null
R6176:Tle2 UTSW 10 81587334 missense probably damaging 0.99
R6200:Tle2 UTSW 10 81588872 missense probably damaging 1.00
R6914:Tle2 UTSW 10 81586356 missense probably damaging 1.00
R7367:Tle2 UTSW 10 81580318 missense probably damaging 0.99
R7600:Tle2 UTSW 10 81586313 nonsense probably null
R7729:Tle2 UTSW 10 81587147 missense probably damaging 0.99
R8333:Tle2 UTSW 10 81577684 missense probably damaging 1.00
R8511:Tle2 UTSW 10 81587996 missense probably damaging 1.00
R9562:Tle2 UTSW 10 81581733 missense probably benign 0.11
R9565:Tle2 UTSW 10 81581733 missense probably benign 0.11
T0970:Tle2 UTSW 10 81580285 missense possibly damaging 0.71
Z1177:Tle2 UTSW 10 81582446 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTATTAGCTGACAGAGGCAGAG -3'
(R):5'- GAGCACCATGGACACAGTTC -3'

Sequencing Primer
(F):5'- GTAGAGCCCTGCCTAGAATCCTAG -3'
(R):5'- TGGACACAGTTCCCATGGATC -3'
Posted On 2015-07-21