Incidental Mutation 'R4440:Tespa1'
ID 329731
Institutional Source Beutler Lab
Gene Symbol Tespa1
Ensembl Gene ENSMUSG00000034833
Gene Name thymocyte expressed, positive selection associated 1
Synonyms
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 130322870-130364111 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130361957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 283 (R283C)
Ref Sequence ENSEMBL: ENSMUSP00000047284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042586] [ENSMUST00000217702]
AlphaFold Q3U132
Predicted Effect probably damaging
Transcript: ENSMUST00000042586
AA Change: R283C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047284
Gene: ENSMUSG00000034833
AA Change: R283C

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
KRAP_IP3R_bind 128 292 2.24e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217702
Meta Mutation Damage Score 0.4346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired late thymocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
Bicdl2 C T 17: 23,667,616 A393V probably benign Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Tespa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tespa1 APN 10 130355484 missense probably damaging 1.00
R0081:Tespa1 UTSW 10 130360850 missense probably damaging 1.00
R0544:Tespa1 UTSW 10 130360811 missense probably damaging 1.00
R1381:Tespa1 UTSW 10 130360691 missense probably benign 0.45
R1781:Tespa1 UTSW 10 130348250 missense probably benign 0.37
R1912:Tespa1 UTSW 10 130354723 missense probably benign 0.37
R1927:Tespa1 UTSW 10 130348239 missense probably benign 0.01
R2428:Tespa1 UTSW 10 130362075 missense probably damaging 0.99
R3907:Tespa1 UTSW 10 130356797 splice site probably benign
R4439:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4441:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4836:Tespa1 UTSW 10 130362159 missense probably benign 0.00
R5045:Tespa1 UTSW 10 130362035 nonsense probably null
R5566:Tespa1 UTSW 10 130355487 nonsense probably null
R5670:Tespa1 UTSW 10 130354755 missense probably damaging 0.96
R5691:Tespa1 UTSW 10 130354769 critical splice donor site probably null
R6173:Tespa1 UTSW 10 130347303 missense probably benign 0.08
R7325:Tespa1 UTSW 10 130362041 missense probably damaging 1.00
R7455:Tespa1 UTSW 10 130360690 missense probably benign 0.00
R7577:Tespa1 UTSW 10 130354755 missense probably damaging 0.96
R7783:Tespa1 UTSW 10 130356883 missense probably damaging 1.00
R8048:Tespa1 UTSW 10 130347339 missense probably damaging 1.00
R8719:Tespa1 UTSW 10 130348239 missense probably benign 0.01
R8768:Tespa1 UTSW 10 130362158 missense probably benign 0.19
R8885:Tespa1 UTSW 10 130362447 missense probably benign 0.03
R9393:Tespa1 UTSW 10 130347197 missense probably damaging 1.00
Z1176:Tespa1 UTSW 10 130361895 missense probably damaging 0.99
Z1177:Tespa1 UTSW 10 130362430 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTACCAATGAGCTCCTAGAGTCAC -3'
(R):5'- AAGGGCTTGCCTATGCTCAG -3'

Sequencing Primer
(F):5'- CCGGTTTAAGCAGGTGCAGAC -3'
(R):5'- GCCTATGCTCAGGGTCTTGC -3'
Posted On 2015-07-21