Incidental Mutation 'R4440:Bicdl2'
ID 329741
Institutional Source Beutler Lab
Gene Symbol Bicdl2
Ensembl Gene ENSMUSG00000043782
Gene Name BICD family like cargo adaptor 2
Synonyms Ccdc64b
MMRRC Submission 041705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock # R4440 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 23660523-23668610 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23667616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 393 (A393V)
Ref Sequence ENSEMBL: ENSMUSP00000053808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047436] [ENSMUST00000062967] [ENSMUST00000095579] [ENSMUST00000115489] [ENSMUST00000115490] [ENSMUST00000138190]
AlphaFold Q8CHW5
Predicted Effect probably benign
Transcript: ENSMUST00000047436
SMART Domains Protein: ENSMUSP00000038137
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062967
AA Change: A393V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053808
Gene: ENSMUSG00000043782
AA Change: A393V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
coiled coil region 63 293 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
coiled coil region 354 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095579
SMART Domains Protein: ENSMUSP00000093239
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115489
SMART Domains Protein: ENSMUSP00000111152
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 11 47 6e-18 BLAST
WD40 61 97 2.67e-1 SMART
Blast:WD40 115 150 8e-12 BLAST
WD40 153 192 1.28e-6 SMART
Blast:WD40 196 241 3e-25 BLAST
WD40 244 280 7.36e1 SMART
low complexity region 290 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115490
SMART Domains Protein: ENSMUSP00000111153
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 7e-19 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 6e-12 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 8e-26 BLAST
Blast:WD40 248 279 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133849
Predicted Effect probably benign
Transcript: ENSMUST00000135259
SMART Domains Protein: ENSMUSP00000119920
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 32 67 9e-13 BLAST
WD40 70 109 1.28e-6 SMART
Blast:WD40 113 186 4e-20 BLAST
Blast:WD40 189 209 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138190
SMART Domains Protein: ENSMUSP00000123075
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 6e-20 BLAST
WD40 65 101 2.67e-1 SMART
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp G T 2: 168,184,801 H191Q possibly damaging Het
Afdn T C 17: 13,850,890 W782R probably damaging Het
Alpl A T 4: 137,747,813 W270R probably damaging Het
Angpt4 G T 2: 151,944,646 G508C probably damaging Het
Armc8 T A 9: 99,484,034 H609L probably benign Het
Atg2a T C 19: 6,255,829 probably null Het
C6 A T 15: 4,735,251 K143M possibly damaging Het
Cfc1 T A 1: 34,544,102 probably benign Het
Ctnna3 A G 10: 64,260,935 I417M probably benign Het
Dnhd1 G A 7: 105,696,728 W2307* probably null Het
Dpysl5 T C 5: 30,792,268 F461L probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fip1l1 T C 5: 74,536,785 probably benign Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Fsip2 A G 2: 82,991,206 D5761G possibly damaging Het
Hdac4 C A 1: 91,945,995 G957C probably damaging Het
Klhl8 A G 5: 103,867,567 I421T probably benign Het
Kntc1 T C 5: 123,794,153 C1337R probably damaging Het
Lpin3 A G 2: 160,898,645 N370S probably benign Het
Man2a2 C A 7: 80,351,715 R1148L probably benign Het
Nav2 C T 7: 49,552,037 T1453I possibly damaging Het
Nav2 A G 7: 49,575,263 probably benign Het
Ndufaf5 T A 2: 140,170,725 V5D probably benign Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Ntrk2 G C 13: 59,060,312 Q657H probably damaging Het
Olfr1212 G A 2: 88,959,341 E292K probably benign Het
Olfr1248 G T 2: 89,618,168 T8K probably damaging Het
Polr1a A G 6: 71,950,848 D861G probably damaging Het
Pramef20 A T 4: 144,372,867 F443I probably benign Het
Pwwp2b T C 7: 139,255,639 I332T probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Slc14a2 A G 18: 78,195,747 V219A probably benign Het
Slc7a2 T C 8: 40,902,649 I245T probably benign Het
Smok3c T A 5: 138,064,604 Y118N possibly damaging Het
Taok2 C T 7: 126,866,521 R367Q possibly damaging Het
Tbl1xr1 A G 3: 22,200,588 probably null Het
Tbr1 A T 2: 61,804,838 D44V possibly damaging Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Vmn1r231 T C 17: 20,890,456 R66G possibly damaging Het
Xab2 T C 8: 3,616,353 E185G probably benign Het
Other mutations in Bicdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Bicdl2 APN 17 23668131 missense probably damaging 1.00
IGL03283:Bicdl2 APN 17 23667181 missense probably damaging 1.00
R1013:Bicdl2 UTSW 17 23665403 unclassified probably benign
R1351:Bicdl2 UTSW 17 23667545 unclassified probably benign
R1512:Bicdl2 UTSW 17 23668109 missense probably damaging 0.96
R1768:Bicdl2 UTSW 17 23665949 missense probably damaging 1.00
R2886:Bicdl2 UTSW 17 23666758 splice site probably null
R4154:Bicdl2 UTSW 17 23666092 splice site probably null
R5133:Bicdl2 UTSW 17 23661821 missense unknown
R5358:Bicdl2 UTSW 17 23667564 missense probably benign 0.00
R6759:Bicdl2 UTSW 17 23666744 splice site probably null
R7855:Bicdl2 UTSW 17 23666017 nonsense probably null
R8557:Bicdl2 UTSW 17 23667562 missense probably benign 0.02
R8871:Bicdl2 UTSW 17 23666803 missense probably damaging 1.00
R9036:Bicdl2 UTSW 17 23668184 missense probably damaging 1.00
R9609:Bicdl2 UTSW 17 23665539 missense
Predicted Primers PCR Primer
(F):5'- CGCCACCTGATTCAAAGGATTC -3'
(R):5'- GGCTGAAGCTTCTGAGTCAAAATG -3'

Sequencing Primer
(F):5'- CACTCTGAGTTTGAACACAGGCTG -3'
(R):5'- ATGAAGGCTATACTCCTGTCAGG -3'
Posted On 2015-07-21