Incidental Mutation 'R0047:Spic'
ID 32975
Institutional Source Beutler Lab
Gene Symbol Spic
Ensembl Gene ENSMUSG00000004359
Gene Name Spi-C transcription factor (Spi-1/PU.1 related)
Synonyms Spi-C, C76795, Prf
MMRRC Submission 038341-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.638) question?
Stock # R0047 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 10
Chromosomal Location 88511131-88518885 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88511803 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 151 (L151P)
Ref Sequence ENSEMBL: ENSMUSP00000118799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004473] [ENSMUST00000133724] [ENSMUST00000138734]
AlphaFold Q6P3D7
Predicted Effect probably damaging
Transcript: ENSMUST00000004473
AA Change: L151P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004473
Gene: ENSMUSG00000004359
AA Change: L151P

DomainStartEndE-ValueType
ETS 111 199 6.67e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133724
Predicted Effect probably damaging
Transcript: ENSMUST00000138734
AA Change: L151P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118799
Gene: ENSMUSG00000004359
AA Change: L151P

DomainStartEndE-ValueType
ETS 111 167 1.14e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220161
Meta Mutation Damage Score 0.9252 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates the development of red pulp macrophages, which are necessary for iron homeostasis and the recycling of red blood cells. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygote null mice have prenatal lethality with incomplete penetrance, absent red pulp macrophages, decreased phagocytosis of senescent red blood cell, and enlargement of spleens with age due to an increase in splenic iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,772,025 (GRCm39) T405A probably damaging Het
Acer1 A T 17: 57,262,624 (GRCm39) D175E possibly damaging Het
Acsf2 T C 11: 94,460,168 (GRCm39) I395V probably benign Het
Adamts9 G A 6: 92,882,287 (GRCm39) probably benign Het
Amigo3 T C 9: 107,931,857 (GRCm39) S427P probably benign Het
Ankrd35 A G 3: 96,591,379 (GRCm39) K555R probably benign Het
Arhgap35 A T 7: 16,295,917 (GRCm39) H1049Q probably benign Het
Arhgef5 G A 6: 43,242,555 (GRCm39) probably null Het
Arid4a T G 12: 71,122,193 (GRCm39) L858W probably damaging Het
Bbox1 A G 2: 110,098,647 (GRCm39) F310S probably damaging Het
Bhlhe22 T C 3: 18,109,733 (GRCm39) L261P probably damaging Het
Bltp1 T A 3: 36,962,341 (GRCm39) L481M possibly damaging Het
Bmper T A 9: 23,317,982 (GRCm39) C534S probably damaging Het
Cacna1d T G 14: 30,068,747 (GRCm39) probably benign Het
Camk2g G A 14: 20,821,136 (GRCm39) probably benign Het
Capn12 G A 7: 28,589,812 (GRCm39) probably null Het
Cdkl4 T G 17: 80,858,274 (GRCm39) N115T probably benign Het
Chchd1 T C 14: 20,754,231 (GRCm39) S48P possibly damaging Het
Chia1 G T 3: 106,022,573 (GRCm39) C49F probably damaging Het
Cnot7 A G 8: 40,948,962 (GRCm39) probably benign Het
Crh T C 3: 19,748,201 (GRCm39) E147G probably damaging Het
Cux1 T C 5: 136,392,107 (GRCm39) probably benign Het
Cyp2b19 T A 7: 26,466,251 (GRCm39) D351E probably benign Het
Dctn1 G T 6: 83,159,614 (GRCm39) G31* probably null Het
Duox1 T A 2: 122,177,122 (GRCm39) probably benign Het
Egflam T G 15: 7,282,911 (GRCm39) E382A possibly damaging Het
Ext1 T C 15: 53,208,542 (GRCm39) N73S probably benign Het
Ffar4 A G 19: 38,102,452 (GRCm39) probably benign Het
Glg1 A T 8: 111,892,214 (GRCm39) M866K probably damaging Het
Golm1 T A 13: 59,792,914 (GRCm39) H197L probably benign Het
Gtse1 A G 15: 85,746,579 (GRCm39) K132E probably damaging Het
Gxylt2 A T 6: 100,710,339 (GRCm39) probably benign Het
Hrc T A 7: 44,986,113 (GRCm39) S421R probably benign Het
Ighg2c T A 12: 113,251,788 (GRCm39) probably benign Het
Ihh A G 1: 74,985,750 (GRCm39) I245T probably benign Het
Ilf3 T A 9: 21,300,010 (GRCm39) M65K possibly damaging Het
Insr A G 8: 3,252,947 (GRCm39) V404A probably damaging Het
Irak2 G T 6: 113,649,914 (GRCm39) probably benign Het
Irak2 G A 6: 113,655,699 (GRCm39) V367I probably benign Het
Kat7 A C 11: 95,191,034 (GRCm39) N119K probably benign Het
Kif9 A G 9: 110,314,106 (GRCm39) I33V probably benign Het
Klf17 A G 4: 117,618,229 (GRCm39) Y43H probably benign Het
Kng2 T A 16: 22,806,313 (GRCm39) T629S possibly damaging Het
Lama1 A T 17: 68,102,181 (GRCm39) probably benign Het
Lamb1 T C 12: 31,328,600 (GRCm39) I188T possibly damaging Het
Lpp T A 16: 24,480,550 (GRCm39) probably benign Het
Lrp12 T C 15: 39,741,635 (GRCm39) E360G probably damaging Het
Mark2 A C 19: 7,260,942 (GRCm39) probably benign Het
Mmp3 T C 9: 7,451,910 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,928,727 (GRCm39) probably benign Het
Mtr A T 13: 12,237,112 (GRCm39) S569T probably damaging Het
Myh13 T A 11: 67,258,063 (GRCm39) S1752T probably benign Het
Myo5a T A 9: 75,063,489 (GRCm39) L565H probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nfkb1 A T 3: 135,300,814 (GRCm39) L72* probably null Het
Numa1 A G 7: 101,658,660 (GRCm39) K296E probably damaging Het
Obi1 T A 14: 104,740,780 (GRCm39) probably null Het
Or51ab3 A T 7: 103,201,529 (GRCm39) Y179F probably damaging Het
Or5ac19 C T 16: 59,089,574 (GRCm39) G152D probably damaging Het
Or5b120 A G 19: 13,479,953 (GRCm39) E82G probably benign Het
Or5h18 T A 16: 58,847,587 (GRCm39) M228L probably benign Het
Or5p80 A G 7: 108,229,759 (GRCm39) I187V probably benign Het
Pcdhb5 A T 18: 37,454,321 (GRCm39) I234F possibly damaging Het
Pgm5 T A 19: 24,661,920 (GRCm39) I545F probably damaging Het
Pla2g2c T C 4: 138,470,901 (GRCm39) probably benign Het
Pnpla7 A T 2: 24,901,618 (GRCm39) E548V probably damaging Het
Ppm1m C A 9: 106,073,895 (GRCm39) E273* probably null Het
Ppp2r1b C T 9: 50,772,873 (GRCm39) R117* probably null Het
Rabgap1l G A 1: 160,059,359 (GRCm39) probably benign Het
Rapgef6 T A 11: 54,437,204 (GRCm39) M49K possibly damaging Het
Rhox4f A C X: 36,789,122 (GRCm39) V15G probably benign Het
Rtel1 T G 2: 180,965,198 (GRCm39) I146M probably damaging Het
Sdr9c7 A T 10: 127,739,541 (GRCm39) M219L probably benign Het
Serpina3g T A 12: 104,206,543 (GRCm39) S115T possibly damaging Het
Serpinb1a A T 13: 33,034,259 (GRCm39) L44Q probably damaging Het
Slc13a4 A G 6: 35,264,297 (GRCm39) I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 (GRCm39) L177P probably damaging Het
Slc47a2 C T 11: 61,227,068 (GRCm39) V167M possibly damaging Het
Snrnp200 C T 2: 127,076,874 (GRCm39) probably benign Het
Snx13 C A 12: 35,151,123 (GRCm39) probably benign Het
Snx25 C T 8: 46,494,402 (GRCm39) A828T probably damaging Het
Ssu2 G A 6: 112,351,781 (GRCm39) H315Y probably damaging Het
Stk32a T C 18: 43,446,443 (GRCm39) probably benign Het
Tbx3 A T 5: 119,818,511 (GRCm39) E382V probably damaging Het
Tcaf2 A G 6: 42,606,547 (GRCm39) I469T probably benign Het
Tln2 A G 9: 67,147,954 (GRCm39) probably benign Het
Top2a T A 11: 98,888,682 (GRCm39) I1260L probably benign Het
Treml1 C A 17: 48,672,008 (GRCm39) S91* probably null Het
Trim26 T C 17: 37,168,756 (GRCm39) probably benign Het
Trmt11 T C 10: 30,411,239 (GRCm39) N418S probably benign Het
Ttf1 A G 2: 28,974,667 (GRCm39) Y801C probably damaging Het
Usp34 C T 11: 23,414,403 (GRCm39) A2782V probably benign Het
Vmn2r77 T C 7: 86,460,858 (GRCm39) V728A probably benign Het
Vps4a T C 8: 107,763,333 (GRCm39) L29P probably damaging Het
Wdfy3 A G 5: 102,091,899 (GRCm39) I480T probably damaging Het
Wdr41 A G 13: 95,146,795 (GRCm39) I197V probably damaging Het
Ywhag A T 5: 135,940,153 (GRCm39) V147E probably damaging Het
Zan A G 5: 137,401,918 (GRCm39) M4058T unknown Het
Zfp236 C T 18: 82,698,817 (GRCm39) C88Y probably damaging Het
Other mutations in Spic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Spic APN 10 88,511,729 (GRCm39) missense probably damaging 1.00
IGL01503:Spic APN 10 88,511,623 (GRCm39) missense probably damaging 0.96
IGL01611:Spic APN 10 88,511,864 (GRCm39) missense possibly damaging 0.69
IGL01792:Spic APN 10 88,515,807 (GRCm39) missense possibly damaging 0.85
R0047:Spic UTSW 10 88,511,803 (GRCm39) missense probably damaging 1.00
R0126:Spic UTSW 10 88,511,924 (GRCm39) missense probably damaging 1.00
R0166:Spic UTSW 10 88,511,579 (GRCm39) missense possibly damaging 0.84
R0585:Spic UTSW 10 88,511,905 (GRCm39) missense probably damaging 1.00
R4066:Spic UTSW 10 88,511,545 (GRCm39) missense possibly damaging 0.63
R4067:Spic UTSW 10 88,511,545 (GRCm39) missense possibly damaging 0.63
R4436:Spic UTSW 10 88,512,817 (GRCm39) missense probably benign 0.03
R4748:Spic UTSW 10 88,511,752 (GRCm39) missense probably damaging 1.00
R5001:Spic UTSW 10 88,511,761 (GRCm39) missense possibly damaging 0.61
R8165:Spic UTSW 10 88,513,428 (GRCm39) missense probably damaging 0.98
R8247:Spic UTSW 10 88,511,923 (GRCm39) missense probably damaging 1.00
R8411:Spic UTSW 10 88,514,498 (GRCm39) missense possibly damaging 0.74
R8681:Spic UTSW 10 88,511,847 (GRCm39) missense possibly damaging 0.89
R9700:Spic UTSW 10 88,515,757 (GRCm39) missense probably benign 0.14
R9777:Spic UTSW 10 88,514,421 (GRCm39) missense possibly damaging 0.59
W0251:Spic UTSW 10 88,515,766 (GRCm39) missense probably damaging 0.97
X0018:Spic UTSW 10 88,514,427 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TTGGAGAACAGCCTCGCTGAAC -3'
(R):5'- ATCTTTCAGGCCCGCCAATGAC -3'

Sequencing Primer
(F):5'- GAACTGGTAGGTCAGCTTTCTCC -3'
(R):5'- TCATCGAGTAAGCAGGCTCATTG -3'
Posted On 2013-05-09