Mutagenetix > Incidental Mutation

Incidental Mutation 'R4441:Trpm1'

329764

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, melastatin, 4732499L03Rik, LTRPC1

MMRRC Submission

041706-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4441 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63803583-63919523 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63851666 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 12 (D12G)

Ref Sequence

ENSEMBL: ENSMUSP00000146140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206107] [ENSMUST00000206314] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083651

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: D128G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: D128G

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107516
AA Change: I128V

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141574
AA Change: D184G

Predicted Effect

probably damaging
Transcript: ENSMUST00000177102
AA Change: D12G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: D12G

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177295
AA Change: D60G

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205348
AA Change: D128G

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

unknown
Transcript: ENSMUST00000205690
AA Change: D12G

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: D12G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: D128G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206107
AA Change: D12G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206314
AA Change: D128G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000205731
AA Change: D12G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205960

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

probably benign
Transcript: ENSMUST00000206049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206453

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205728

Meta Mutation Damage Score

0.6729

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,127,024 (GRCm39)	R1238S	probably benign	Het
Ankmy1	A	T	1: 92,816,383 (GRCm39)	Y244N	possibly damaging	Het
Asxl3	C	T	18: 22,657,290 (GRCm39)	P1767S	probably damaging	Het
C1qtnf7	A	T	5: 43,766,612 (GRCm39)	K70N	possibly damaging	Het
Cibar1	A	G	4: 12,157,733 (GRCm39)	M261T	probably damaging	Het
Fam78b	C	A	1: 166,906,491 (GRCm39)	Q217K	probably damaging	Het
Garem1	T	C	18: 21,301,807 (GRCm39)	T127A	possibly damaging	Het
Gls	A	T	1: 52,235,322 (GRCm39)		probably null	Het
Gm12790	A	C	4: 101,825,337 (GRCm39)	S26A	probably damaging	Het
Gm136	T	C	4: 34,755,911 (GRCm39)	D34G	probably benign	Het
Gmds	A	G	13: 32,124,461 (GRCm39)		probably null	Het
Hdac9	G	T	12: 34,439,375 (GRCm39)	H401N	probably damaging	Het
Hmcn1	T	C	1: 150,533,210 (GRCm39)	I3026V	probably null	Het
Igkv6-20	A	T	6: 70,313,101 (GRCm39)	M24K	probably damaging	Het
Ilf2	T	C	3: 90,394,769 (GRCm39)	L339P	probably benign	Het
Insr	T	A	8: 3,244,902 (GRCm39)	K501N	probably benign	Het
Lyst	G	A	13: 13,809,968 (GRCm39)	R546H	probably damaging	Het
Mcm5	T	C	8: 75,839,172 (GRCm39)	S142P	probably benign	Het
Mcpt9	A	G	14: 56,265,009 (GRCm39)	V164A	probably damaging	Het
Ncapd3	T	A	9: 26,962,941 (GRCm39)	D415E	possibly damaging	Het
Nfia	T	C	4: 97,661,150 (GRCm39)		probably null	Het
Nipbl	G	C	15: 8,396,142 (GRCm39)	Q144E	probably damaging	Het
Or51g1	A	T	7: 102,633,516 (GRCm39)	V285E	possibly damaging	Het
Or51q1c	T	G	7: 103,653,279 (GRCm39)	F266V	probably damaging	Het
Or6z5	T	C	7: 6,477,924 (GRCm39)	S272P	probably benign	Het
Pcdhgb8	A	G	18: 37,896,114 (GRCm39)	I395V	possibly damaging	Het
Plcz1	T	A	6: 139,936,413 (GRCm39)	L605F	probably benign	Het
Prph	G	A	15: 98,955,005 (GRCm39)	S325N	probably damaging	Het
Ptpn23	A	G	9: 110,221,793 (GRCm39)	M131T	probably benign	Het
Rab3ip	T	G	10: 116,751,837 (GRCm39)	D278A	probably benign	Het
Rasgrf2	T	C	13: 92,131,797 (GRCm39)	D620G	possibly damaging	Het
Rbm5	A	G	9: 107,626,887 (GRCm39)		probably benign	Het
Rc3h2	A	G	2: 37,304,526 (GRCm39)		probably null	Het
Saxo5	C	T	8: 3,526,105 (GRCm39)	S86L	probably damaging	Het
Tbxa2r	T	C	10: 81,168,925 (GRCm39)	S205P	probably damaging	Het
Tenm4	A	G	7: 96,545,022 (GRCm39)	N2375S	probably benign	Het
Tespa1	C	T	10: 130,197,826 (GRCm39)	R283C	probably damaging	Het
Tle2	A	G	10: 81,417,516 (GRCm39)	E227G	possibly damaging	Het
Tnik	A	G	3: 28,618,246 (GRCm39)	I266V	possibly damaging	Het
Tnn	T	G	1: 159,943,650 (GRCm39)	E1054D	probably benign	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Vrk3	C	T	7: 44,424,866 (GRCm39)	T427M	probably benign	Het
Wdr7	T	A	18: 63,888,281 (GRCm39)	Y585N	probably damaging	Het
Zgrf1	T	A	3: 127,379,786 (GRCm39)	N223K	possibly damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	63,893,198 (GRCm39)	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	63,897,215 (GRCm39)	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	63,885,572 (GRCm39)	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	63,893,312 (GRCm39)	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	63,860,578 (GRCm39)	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	63,884,767 (GRCm39)	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	63,854,276 (GRCm39)	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	63,893,329 (GRCm39)	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	63,918,637 (GRCm39)	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	63,876,645 (GRCm39)	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	63,884,742 (GRCm39)	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	63,858,723 (GRCm39)	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	63,860,613 (GRCm39)	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	63,867,362 (GRCm39)	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	63,884,800 (GRCm39)	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	63,895,690 (GRCm39)	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	63,868,869 (GRCm39)	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	63,890,175 (GRCm39)	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	63,918,862 (GRCm39)	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	63,848,972 (GRCm39)	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	63,868,881 (GRCm39)	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	63,868,908 (GRCm39)	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	63,918,309 (GRCm39)	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	63,848,998 (GRCm39)	intron	probably benign
R0012:Trpm1	UTSW	7	63,918,339 (GRCm39)	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	63,897,970 (GRCm39)	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	63,893,334 (GRCm39)	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	63,894,590 (GRCm39)	unclassified	probably benign
R0463:Trpm1	UTSW	7	63,870,002 (GRCm39)	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	63,852,801 (GRCm39)	splice site	probably null
R1397:Trpm1	UTSW	7	63,867,406 (GRCm39)	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	63,873,565 (GRCm39)	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	63,890,283 (GRCm39)	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	63,885,569 (GRCm39)	nonsense	probably null
R1827:Trpm1	UTSW	7	63,884,755 (GRCm39)	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	63,876,530 (GRCm39)	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	63,880,016 (GRCm39)	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	63,917,764 (GRCm39)	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	63,858,182 (GRCm39)	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	63,858,780 (GRCm39)	intron	probably null
R2054:Trpm1	UTSW	7	63,890,303 (GRCm39)	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	63,884,736 (GRCm39)	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	63,859,724 (GRCm39)	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	63,918,849 (GRCm39)	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	63,884,760 (GRCm39)	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	63,849,061 (GRCm39)	nonsense	probably null
R3615:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	63,867,475 (GRCm39)	intron	probably benign
R3822:Trpm1	UTSW	7	63,867,451 (GRCm39)	intron	probably benign
R4490:Trpm1	UTSW	7	63,858,660 (GRCm39)	nonsense	probably null
R4666:Trpm1	UTSW	7	63,852,782 (GRCm39)	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	63,893,248 (GRCm39)	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	63,884,800 (GRCm39)	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	63,858,054 (GRCm39)	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	63,894,580 (GRCm39)	unclassified	probably benign
R5030:Trpm1	UTSW	7	63,885,579 (GRCm39)	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	63,887,441 (GRCm39)	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	63,918,702 (GRCm39)	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	63,858,694 (GRCm39)	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	63,870,018 (GRCm39)	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	63,858,159 (GRCm39)	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	63,918,710 (GRCm39)	nonsense	probably null
R5947:Trpm1	UTSW	7	63,873,547 (GRCm39)	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	63,876,553 (GRCm39)	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	63,918,450 (GRCm39)	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	63,917,724 (GRCm39)	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	63,918,226 (GRCm39)	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	63,848,942 (GRCm39)	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	63,918,252 (GRCm39)	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	63,803,781 (GRCm39)	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	63,890,343 (GRCm39)	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	63,893,181 (GRCm39)	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	63,876,462 (GRCm39)	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	63,885,593 (GRCm39)	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	63,918,445 (GRCm39)	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	63,854,333 (GRCm39)	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	63,868,854 (GRCm39)	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	63,859,729 (GRCm39)	nonsense	probably null
R7367:Trpm1	UTSW	7	63,918,549 (GRCm39)	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	63,858,723 (GRCm39)	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	63,890,330 (GRCm39)	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	63,858,657 (GRCm39)	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	63,854,303 (GRCm39)	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	63,897,939 (GRCm39)	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	63,851,689 (GRCm39)	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	63,858,718 (GRCm39)	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	63,849,017 (GRCm39)	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	63,851,699 (GRCm39)	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	63,918,541 (GRCm39)	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	63,897,155 (GRCm39)	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	63,874,356 (GRCm39)	splice site	probably null
R8813:Trpm1	UTSW	7	63,851,756 (GRCm39)	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	63,918,628 (GRCm39)	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	63,858,089 (GRCm39)	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	63,848,943 (GRCm39)	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	63,890,319 (GRCm39)	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	63,884,713 (GRCm39)	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	63,873,623 (GRCm39)	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	63,918,480 (GRCm39)	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	63,873,446 (GRCm39)	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	63,803,616 (GRCm39)	unclassified	probably benign
R9616:Trpm1	UTSW	7	63,858,132 (GRCm39)	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	63,898,041 (GRCm39)	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	63,918,658 (GRCm39)	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	63,854,342 (GRCm39)	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	63,852,879 (GRCm39)	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	63,867,439 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATTAATGCAGAGGGCCCCAAG -3'
(R):5'- TTCAGTGAGTCCATCAGCGC -3'

Sequencing Primer
(F):5'- GATATAGAGAGCCTCCAGACACTG -3'
(R):5'- TGAGTCCATCAGCGCAGACTC -3'

Posted On

2015-07-21