Incidental Mutation 'R4441:Abca16'
ID 329768
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
MMRRC Submission 041706-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4441 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120127024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1238 (R1238S)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably benign
Transcript: ENSMUST00000056042
AA Change: R1237S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: R1237S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: R1238S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: R1238S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy1 A T 1: 92,816,383 (GRCm39) Y244N possibly damaging Het
Asxl3 C T 18: 22,657,290 (GRCm39) P1767S probably damaging Het
C1qtnf7 A T 5: 43,766,612 (GRCm39) K70N possibly damaging Het
Cibar1 A G 4: 12,157,733 (GRCm39) M261T probably damaging Het
Fam78b C A 1: 166,906,491 (GRCm39) Q217K probably damaging Het
Garem1 T C 18: 21,301,807 (GRCm39) T127A possibly damaging Het
Gls A T 1: 52,235,322 (GRCm39) probably null Het
Gm12790 A C 4: 101,825,337 (GRCm39) S26A probably damaging Het
Gm136 T C 4: 34,755,911 (GRCm39) D34G probably benign Het
Gmds A G 13: 32,124,461 (GRCm39) probably null Het
Hdac9 G T 12: 34,439,375 (GRCm39) H401N probably damaging Het
Hmcn1 T C 1: 150,533,210 (GRCm39) I3026V probably null Het
Igkv6-20 A T 6: 70,313,101 (GRCm39) M24K probably damaging Het
Ilf2 T C 3: 90,394,769 (GRCm39) L339P probably benign Het
Insr T A 8: 3,244,902 (GRCm39) K501N probably benign Het
Lyst G A 13: 13,809,968 (GRCm39) R546H probably damaging Het
Mcm5 T C 8: 75,839,172 (GRCm39) S142P probably benign Het
Mcpt9 A G 14: 56,265,009 (GRCm39) V164A probably damaging Het
Ncapd3 T A 9: 26,962,941 (GRCm39) D415E possibly damaging Het
Nfia T C 4: 97,661,150 (GRCm39) probably null Het
Nipbl G C 15: 8,396,142 (GRCm39) Q144E probably damaging Het
Or51g1 A T 7: 102,633,516 (GRCm39) V285E possibly damaging Het
Or51q1c T G 7: 103,653,279 (GRCm39) F266V probably damaging Het
Or6z5 T C 7: 6,477,924 (GRCm39) S272P probably benign Het
Pcdhgb8 A G 18: 37,896,114 (GRCm39) I395V possibly damaging Het
Plcz1 T A 6: 139,936,413 (GRCm39) L605F probably benign Het
Prph G A 15: 98,955,005 (GRCm39) S325N probably damaging Het
Ptpn23 A G 9: 110,221,793 (GRCm39) M131T probably benign Het
Rab3ip T G 10: 116,751,837 (GRCm39) D278A probably benign Het
Rasgrf2 T C 13: 92,131,797 (GRCm39) D620G possibly damaging Het
Rbm5 A G 9: 107,626,887 (GRCm39) probably benign Het
Rc3h2 A G 2: 37,304,526 (GRCm39) probably null Het
Saxo5 C T 8: 3,526,105 (GRCm39) S86L probably damaging Het
Tbxa2r T C 10: 81,168,925 (GRCm39) S205P probably damaging Het
Tenm4 A G 7: 96,545,022 (GRCm39) N2375S probably benign Het
Tespa1 C T 10: 130,197,826 (GRCm39) R283C probably damaging Het
Tle2 A G 10: 81,417,516 (GRCm39) E227G possibly damaging Het
Tnik A G 3: 28,618,246 (GRCm39) I266V possibly damaging Het
Tnn T G 1: 159,943,650 (GRCm39) E1054D probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpm1 A G 7: 63,851,666 (GRCm39) D12G probably damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wdr7 T A 18: 63,888,281 (GRCm39) Y585N probably damaging Het
Zgrf1 T A 3: 127,379,786 (GRCm39) N223K possibly damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4601:Abca16 UTSW 7 120,035,920 (GRCm39) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6161:Abca16 UTSW 7 120,139,934 (GRCm39) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,102,694 (GRCm39) nonsense probably null
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,065,005 (GRCm39) missense probably damaging 1.00
R8413:Abca16 UTSW 7 120,023,123 (GRCm39) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,126,404 (GRCm39) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCAGTGGTGCTTTCTCAAG -3'
(R):5'- CAGCTCATTCTACTCAAATGGAAG -3'

Sequencing Primer
(F):5'- GTCTGAGAATCGCTTAACCACTAGG -3'
(R):5'- GGAAGAAAACCAGGTTTTTCTTGC -3'
Posted On 2015-07-21