Mutagenetix > Incidental Mutation

Incidental Mutation 'R0047:Usp34'

32977

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

038341-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R0047 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 23464403 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 2782 (A2782V)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129521

Predicted Effect

probably benign
Transcript: ENSMUST00000137823
AA Change: A2801V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: A2801V

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148927

Predicted Effect

probably benign
Transcript: ENSMUST00000180046
AA Change: A2782V

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: A2782V

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Meta Mutation Damage Score

0.0689

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (98/98)

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,264	T405A	probably damaging	Het
4932438A13Rik	T	A	3: 36,908,192	L481M	possibly damaging	Het
Acer1	A	T	17: 56,955,624	D175E	possibly damaging	Het
Acsf2	T	C	11: 94,569,342	I395V	probably benign	Het
Adamts9	G	A	6: 92,905,306		probably benign	Het
Amigo3	T	C	9: 108,054,658	S427P	probably benign	Het
Ankrd35	A	G	3: 96,684,063	K555R	probably benign	Het
Arhgap35	A	T	7: 16,561,992	H1049Q	probably benign	Het
Arhgef5	G	A	6: 43,265,621		probably null	Het
Arid4a	T	G	12: 71,075,419	L858W	probably damaging	Het
Bbox1	A	G	2: 110,268,302	F310S	probably damaging	Het
Bhlhe22	T	C	3: 18,055,569	L261P	probably damaging	Het
Bmper	T	A	9: 23,406,686	C534S	probably damaging	Het
Cacna1d	T	G	14: 30,346,790		probably benign	Het
Camk2g	G	A	14: 20,771,068		probably benign	Het
Capn12	G	A	7: 28,890,387		probably null	Het
Cdkl4	T	G	17: 80,550,845	N115T	probably benign	Het
Chchd1	T	C	14: 20,704,163	S48P	possibly damaging	Het
Chia1	G	T	3: 106,115,257	C49F	probably damaging	Het
Cnot7	A	G	8: 40,495,921		probably benign	Het
Crh	T	C	3: 19,694,037	E147G	probably damaging	Het
Cux1	T	C	5: 136,363,253		probably benign	Het
Cyp2b19	T	A	7: 26,766,826	D351E	probably benign	Het
Dctn1	G	T	6: 83,182,632	G31*	probably null	Het
Duox1	T	A	2: 122,346,641		probably benign	Het
Egflam	T	G	15: 7,253,430	E382A	possibly damaging	Het
Ext1	T	C	15: 53,345,146	N73S	probably benign	Het
Ffar4	A	G	19: 38,114,004		probably benign	Het
Glg1	A	T	8: 111,165,582	M866K	probably damaging	Het
Golm1	T	A	13: 59,645,100	H197L	probably benign	Het
Gtse1	A	G	15: 85,862,378	K132E	probably damaging	Het
Gxylt2	A	T	6: 100,733,378		probably benign	Het
Hrc	T	A	7: 45,336,689	S421R	probably benign	Het
Ighg2c	T	A	12: 113,288,168		probably benign	Het
Ihh	A	G	1: 74,946,591	I245T	probably benign	Het
Ilf3	T	A	9: 21,388,714	M65K	possibly damaging	Het
Insr	A	G	8: 3,202,947	V404A	probably damaging	Het
Irak2	G	T	6: 113,672,953		probably benign	Het
Irak2	G	A	6: 113,678,738	V367I	probably benign	Het
Kat7	A	C	11: 95,300,208	N119K	probably benign	Het
Kif9	A	G	9: 110,485,038	I33V	probably benign	Het
Klf17	A	G	4: 117,761,032	Y43H	probably benign	Het
Kng2	T	A	16: 22,987,563	T629S	possibly damaging	Het
Lama1	A	T	17: 67,795,186		probably benign	Het
Lamb1	T	C	12: 31,278,601	I188T	possibly damaging	Het
Lpp	T	A	16: 24,661,800		probably benign	Het
Lrp12	T	C	15: 39,878,239	E360G	probably damaging	Het
Mark2	A	C	19: 7,283,577		probably benign	Het
Mmp3	T	C	9: 7,451,910		probably benign	Het
Mthfd1l	T	A	10: 3,978,727		probably benign	Het
Mtr	A	T	13: 12,222,226	S569T	probably damaging	Het
Myh13	T	A	11: 67,367,237	S1752T	probably benign	Het
Myo5a	T	A	9: 75,156,207	L565H	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nfkb1	A	T	3: 135,595,053	L72*	probably null	Het
Numa1	A	G	7: 102,009,453	K296E	probably damaging	Het
Olfr1477	A	G	19: 13,502,589	E82G	probably benign	Het
Olfr186	T	A	16: 59,027,224	M228L	probably benign	Het
Olfr201	C	T	16: 59,269,211	G152D	probably damaging	Het
Olfr508	A	G	7: 108,630,552	I187V	probably benign	Het
Olfr613	A	T	7: 103,552,322	Y179F	probably damaging	Het
Pcdhb5	A	T	18: 37,321,268	I234F	possibly damaging	Het
Pgm5	T	A	19: 24,684,556	I545F	probably damaging	Het
Pla2g2c	T	C	4: 138,743,590		probably benign	Het
Pnpla7	A	T	2: 25,011,606	E548V	probably damaging	Het
Ppm1m	C	A	9: 106,196,696	E273*	probably null	Het
Ppp2r1b	C	T	9: 50,861,573	R117*	probably null	Het
Rabgap1l	G	A	1: 160,231,789		probably benign	Het
Rapgef6	T	A	11: 54,546,378	M49K	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Rnf219	T	A	14: 104,503,344		probably null	Het
Rtel1	T	G	2: 181,323,405	I146M	probably damaging	Het
Sdr9c7	A	T	10: 127,903,672	M219L	probably benign	Het
Serpina3g	T	A	12: 104,240,284	S115T	possibly damaging	Het
Serpinb1a	A	T	13: 32,850,276	L44Q	probably damaging	Het
Slc13a4	A	G	6: 35,287,362	I190T	possibly damaging	Het
Slc46a2	A	G	4: 59,914,392	L177P	probably damaging	Het
Slc47a2	C	T	11: 61,336,242	V167M	possibly damaging	Het
Snrnp200	C	T	2: 127,234,954		probably benign	Het
Snx13	C	A	12: 35,101,124		probably benign	Het
Snx25	C	T	8: 46,041,365	A828T	probably damaging	Het
Spic	A	G	10: 88,675,941	L151P	probably damaging	Het
Ssu2	G	A	6: 112,374,820	H315Y	probably damaging	Het
Stk32a	T	C	18: 43,313,378		probably benign	Het
Tbx3	A	T	5: 119,680,446	E382V	probably damaging	Het
Tcaf2	A	G	6: 42,629,613	I469T	probably benign	Het
Tln2	A	G	9: 67,240,672		probably benign	Het
Top2a	T	A	11: 98,997,856	I1260L	probably benign	Het
Treml1	C	A	17: 48,364,980	S91*	probably null	Het
Trim26	T	C	17: 36,857,864		probably benign	Het
Trmt11	T	C	10: 30,535,243	N418S	probably benign	Het
Ttf1	A	G	2: 29,084,655	Y801C	probably damaging	Het
Vmn2r77	T	C	7: 86,811,650	V728A	probably benign	Het
Vps4a	T	C	8: 107,036,701	L29P	probably damaging	Het
Wdfy3	A	G	5: 101,944,033	I480T	probably damaging	Het
Wdr41	A	G	13: 95,010,287	I197V	probably damaging	Het
Ywhag	A	T	5: 135,911,299	V147E	probably damaging	Het
Zan	A	G	5: 137,403,656	M4058T	unknown	Het
Zfp236	C	T	18: 82,680,692	C88Y	probably damaging	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAATTCATTCCGCCAGATGTTCC -3'
(R):5'- AATGCCATAGTAGGCAGGCAGC -3'

Sequencing Primer
(F):5'- ATGTTCCGGTCAACAAGGTC -3'
(R):5'- GATATTCTCTGGACAGTCAGCAC -3'

Posted On

2013-05-09