Incidental Mutation 'R4441:Rbm5'
ID329772
Institutional Source Beutler Lab
Gene Symbol Rbm5
Ensembl Gene ENSMUSG00000032580
Gene NameRNA binding motif protein 5
SynonymsD030069N10Rik
MMRRC Submission 041706-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R4441 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107740371-107770996 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 107749688 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035199] [ENSMUST00000182304] [ENSMUST00000182371] [ENSMUST00000182421] [ENSMUST00000182659] [ENSMUST00000192130]
Predicted Effect probably benign
Transcript: ENSMUST00000035199
SMART Domains Protein: ENSMUSP00000035199
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182304
SMART Domains Protein: ENSMUSP00000138380
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
PDB:2LKZ|A 231 251 5e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182332
Predicted Effect probably benign
Transcript: ENSMUST00000182371
SMART Domains Protein: ENSMUSP00000138119
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182421
SMART Domains Protein: ENSMUSP00000138778
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182422
Predicted Effect probably benign
Transcript: ENSMUST00000182659
SMART Domains Protein: ENSMUSP00000138379
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183307
Predicted Effect probably benign
Transcript: ENSMUST00000192130
SMART Domains Protein: ENSMUSP00000142194
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193342
Predicted Effect probably benign
Transcript: ENSMUST00000194400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194801
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene which encodes a nuclear RNA binding protein that is a component of the spliceosome A complex. The encoded protein plays a role in the induction of cell cycle arrest and apoptosis through pre-mRNA splicing of multiple target genes including the tumor suppressor protein p53. This gene is located within the tumor suppressor region 3p21.3, and may play a role in the inhibition of tumor transformation and progression of several malignancies including lung cancer. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility with azoospermia, male germ cell apoptosis, round spermatid arrest and spermatid differentiation arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,801 R1238S probably benign Het
Ankmy1 A T 1: 92,888,661 Y244N possibly damaging Het
Asxl3 C T 18: 22,524,233 P1767S probably damaging Het
C1qtnf7 A T 5: 43,609,270 K70N possibly damaging Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fam92a A G 4: 12,157,733 M261T probably damaging Het
Garem1 T C 18: 21,168,750 T127A possibly damaging Het
Gls A T 1: 52,196,163 probably null Het
Gm12790 A C 4: 101,968,140 S26A probably damaging Het
Gm136 T C 4: 34,755,911 D34G probably benign Het
Gmds A G 13: 31,940,478 probably null Het
Hdac9 G T 12: 34,389,376 H401N probably damaging Het
Hmcn1 T C 1: 150,657,459 I3026V probably null Het
Igkv6-20 A T 6: 70,336,117 M24K probably damaging Het
Ilf2 T C 3: 90,487,462 L339P probably benign Het
Insr T A 8: 3,194,902 K501N probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcm5 T C 8: 75,112,544 S142P probably benign Het
Mcpt9 A G 14: 56,027,552 V164A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nfia T C 4: 97,772,913 probably null Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Olfr1346 T C 7: 6,474,925 S272P probably benign Het
Olfr578 A T 7: 102,984,309 V285E possibly damaging Het
Olfr638 T G 7: 104,004,072 F266V probably damaging Het
Pcdhgb8 A G 18: 37,763,061 I395V possibly damaging Het
Plcz1 T A 6: 139,990,687 L605F probably benign Het
Prph G A 15: 99,057,124 S325N probably damaging Het
Ptpn23 A G 9: 110,392,725 M131T probably benign Het
Rab3ip T G 10: 116,915,932 D278A probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rc3h2 A G 2: 37,414,514 probably null Het
Tbxa2r T C 10: 81,333,091 S205P probably damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tex45 C T 8: 3,476,105 S86L probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnik A G 3: 28,564,097 I266V possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 A G 7: 64,201,918 D12G probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr7 T A 18: 63,755,210 Y585N probably damaging Het
Zgrf1 T A 3: 127,586,137 N223K possibly damaging Het
Other mutations in Rbm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Rbm5 APN 9 107755846 unclassified probably benign
IGL02319:Rbm5 APN 9 107743865 nonsense probably null
IGL02567:Rbm5 APN 9 107744274 missense probably damaging 1.00
IGL02868:Rbm5 APN 9 107749700 splice site probably benign
IGL02943:Rbm5 APN 9 107744343 missense probably damaging 1.00
IGL02959:Rbm5 APN 9 107754185 unclassified probably benign
IGL03029:Rbm5 APN 9 107754453 missense possibly damaging 0.46
PIT4403001:Rbm5 UTSW 9 107760336 missense probably damaging 1.00
R0001:Rbm5 UTSW 9 107742424 missense probably damaging 1.00
R0242:Rbm5 UTSW 9 107751708 splice site probably benign
R1170:Rbm5 UTSW 9 107742497 missense probably damaging 0.99
R1239:Rbm5 UTSW 9 107752966 unclassified probably benign
R1297:Rbm5 UTSW 9 107744242 missense probably damaging 1.00
R1719:Rbm5 UTSW 9 107743913 critical splice acceptor site probably null
R1764:Rbm5 UTSW 9 107767564 nonsense probably null
R1826:Rbm5 UTSW 9 107742414 missense probably damaging 0.98
R1863:Rbm5 UTSW 9 107750519 missense possibly damaging 0.70
R4112:Rbm5 UTSW 9 107765597 missense probably damaging 1.00
R4207:Rbm5 UTSW 9 107750483 missense probably benign
R4343:Rbm5 UTSW 9 107752196 missense probably damaging 1.00
R4621:Rbm5 UTSW 9 107754146 missense probably damaging 1.00
R4767:Rbm5 UTSW 9 107745213 missense probably damaging 1.00
R5090:Rbm5 UTSW 9 107760312 splice site probably benign
R5404:Rbm5 UTSW 9 107765553 missense probably damaging 1.00
R5876:Rbm5 UTSW 9 107760326 missense probably damaging 1.00
R5959:Rbm5 UTSW 9 107752140 missense probably benign 0.02
R5983:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R5984:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R7436:Rbm5 UTSW 9 107750394 intron probably null
R7447:Rbm5 UTSW 9 107746179 missense probably damaging 1.00
R7867:Rbm5 UTSW 9 107751731 missense probably benign 0.02
R7950:Rbm5 UTSW 9 107751731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCAGTACTGTGTGCAATGTG -3'
(R):5'- CGTTAGCTCACTGGCTTAGAG -3'

Sequencing Primer
(F):5'- GGCAAGTACTTTTACCCACTGAGG -3'
(R):5'- GCTCACTGGCTTAGAGATTAACATC -3'
Posted On2015-07-21