Incidental Mutation 'R4441:Hdac9'
ID329778
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission 041706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4441 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34389376 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 401 (H401N)
Ref Sequence ENSEMBL: ENSMUSP00000147395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
Predicted Effect probably damaging
Transcript: ENSMUST00000110819
AA Change: H442N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: H442N

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209667
AA Change: H398N

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000209750
AA Change: H445N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209902
AA Change: H442N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209990
AA Change: H401N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000210724
AA Change: H442N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000211107
AA Change: H414N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000211752
AA Change: H466N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6121 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,801 R1238S probably benign Het
Ankmy1 A T 1: 92,888,661 Y244N possibly damaging Het
Asxl3 C T 18: 22,524,233 P1767S probably damaging Het
C1qtnf7 A T 5: 43,609,270 K70N possibly damaging Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fam92a A G 4: 12,157,733 M261T probably damaging Het
Garem1 T C 18: 21,168,750 T127A possibly damaging Het
Gls A T 1: 52,196,163 probably null Het
Gm12790 A C 4: 101,968,140 S26A probably damaging Het
Gm136 T C 4: 34,755,911 D34G probably benign Het
Gmds A G 13: 31,940,478 probably null Het
Hmcn1 T C 1: 150,657,459 I3026V probably null Het
Igkv6-20 A T 6: 70,336,117 M24K probably damaging Het
Ilf2 T C 3: 90,487,462 L339P probably benign Het
Insr T A 8: 3,194,902 K501N probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcm5 T C 8: 75,112,544 S142P probably benign Het
Mcpt9 A G 14: 56,027,552 V164A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nfia T C 4: 97,772,913 probably null Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Olfr1346 T C 7: 6,474,925 S272P probably benign Het
Olfr578 A T 7: 102,984,309 V285E possibly damaging Het
Olfr638 T G 7: 104,004,072 F266V probably damaging Het
Pcdhgb8 A G 18: 37,763,061 I395V possibly damaging Het
Plcz1 T A 6: 139,990,687 L605F probably benign Het
Prph G A 15: 99,057,124 S325N probably damaging Het
Ptpn23 A G 9: 110,392,725 M131T probably benign Het
Rab3ip T G 10: 116,915,932 D278A probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rbm5 A G 9: 107,749,688 probably benign Het
Rc3h2 A G 2: 37,414,514 probably null Het
Tbxa2r T C 10: 81,333,091 S205P probably damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tex45 C T 8: 3,476,105 S86L probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnik A G 3: 28,564,097 I266V possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 A G 7: 64,201,918 D12G probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr7 T A 18: 63,755,210 Y585N probably damaging Het
Zgrf1 T A 3: 127,586,137 N223K possibly damaging Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34374140 critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCCTTTGGAAACCAGTGC -3'
(R):5'- TGCACACTCACATATACTTACATTC -3'

Sequencing Primer
(F):5'- CAGTGCTTACAATATCTAACTCAGC -3'
(R):5'- TACTTACATTCACATCCACACTGAC -3'
Posted On2015-07-21