Mutagenetix > Incidental Mutation

Incidental Mutation 'R4441:Rasgrf2'

329781

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

041706-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R4441 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92028519-92268164 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92131797 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 620 (D620G)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

AlphaFold

P70392

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099326
AA Change: D620G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D620G

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142378
AA Change: D19G

SMART Domains

Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: D19G

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
Blast:RasGEFN	187	249	8e-29	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000151408
AA Change: D19G

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D19G

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Meta Mutation Damage Score

0.2853

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,127,024 (GRCm39)	R1238S	probably benign	Het
Ankmy1	A	T	1: 92,816,383 (GRCm39)	Y244N	possibly damaging	Het
Asxl3	C	T	18: 22,657,290 (GRCm39)	P1767S	probably damaging	Het
C1qtnf7	A	T	5: 43,766,612 (GRCm39)	K70N	possibly damaging	Het
Cibar1	A	G	4: 12,157,733 (GRCm39)	M261T	probably damaging	Het
Fam78b	C	A	1: 166,906,491 (GRCm39)	Q217K	probably damaging	Het
Garem1	T	C	18: 21,301,807 (GRCm39)	T127A	possibly damaging	Het
Gls	A	T	1: 52,235,322 (GRCm39)		probably null	Het
Gm12790	A	C	4: 101,825,337 (GRCm39)	S26A	probably damaging	Het
Gm136	T	C	4: 34,755,911 (GRCm39)	D34G	probably benign	Het
Gmds	A	G	13: 32,124,461 (GRCm39)		probably null	Het
Hdac9	G	T	12: 34,439,375 (GRCm39)	H401N	probably damaging	Het
Hmcn1	T	C	1: 150,533,210 (GRCm39)	I3026V	probably null	Het
Igkv6-20	A	T	6: 70,313,101 (GRCm39)	M24K	probably damaging	Het
Ilf2	T	C	3: 90,394,769 (GRCm39)	L339P	probably benign	Het
Insr	T	A	8: 3,244,902 (GRCm39)	K501N	probably benign	Het
Lyst	G	A	13: 13,809,968 (GRCm39)	R546H	probably damaging	Het
Mcm5	T	C	8: 75,839,172 (GRCm39)	S142P	probably benign	Het
Mcpt9	A	G	14: 56,265,009 (GRCm39)	V164A	probably damaging	Het
Ncapd3	T	A	9: 26,962,941 (GRCm39)	D415E	possibly damaging	Het
Nfia	T	C	4: 97,661,150 (GRCm39)		probably null	Het
Nipbl	G	C	15: 8,396,142 (GRCm39)	Q144E	probably damaging	Het
Or51g1	A	T	7: 102,633,516 (GRCm39)	V285E	possibly damaging	Het
Or51q1c	T	G	7: 103,653,279 (GRCm39)	F266V	probably damaging	Het
Or6z5	T	C	7: 6,477,924 (GRCm39)	S272P	probably benign	Het
Pcdhgb8	A	G	18: 37,896,114 (GRCm39)	I395V	possibly damaging	Het
Plcz1	T	A	6: 139,936,413 (GRCm39)	L605F	probably benign	Het
Prph	G	A	15: 98,955,005 (GRCm39)	S325N	probably damaging	Het
Ptpn23	A	G	9: 110,221,793 (GRCm39)	M131T	probably benign	Het
Rab3ip	T	G	10: 116,751,837 (GRCm39)	D278A	probably benign	Het
Rbm5	A	G	9: 107,626,887 (GRCm39)		probably benign	Het
Rc3h2	A	G	2: 37,304,526 (GRCm39)		probably null	Het
Saxo5	C	T	8: 3,526,105 (GRCm39)	S86L	probably damaging	Het
Tbxa2r	T	C	10: 81,168,925 (GRCm39)	S205P	probably damaging	Het
Tenm4	A	G	7: 96,545,022 (GRCm39)	N2375S	probably benign	Het
Tespa1	C	T	10: 130,197,826 (GRCm39)	R283C	probably damaging	Het
Tle2	A	G	10: 81,417,516 (GRCm39)	E227G	possibly damaging	Het
Tnik	A	G	3: 28,618,246 (GRCm39)	I266V	possibly damaging	Het
Tnn	T	G	1: 159,943,650 (GRCm39)	E1054D	probably benign	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Trpm1	A	G	7: 63,851,666 (GRCm39)	D12G	probably damaging	Het
Vrk3	C	T	7: 44,424,866 (GRCm39)	T427M	probably benign	Het
Wdr7	T	A	18: 63,888,281 (GRCm39)	Y585N	probably damaging	Het
Zgrf1	T	A	3: 127,379,786 (GRCm39)	N223K	possibly damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92,159,425 (GRCm39)	splice site	probably benign
IGL01358:Rasgrf2	APN	13	92,130,749 (GRCm39)	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92,174,718 (GRCm39)	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	92,130,857 (GRCm39)	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	92,136,145 (GRCm39)	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92,267,900 (GRCm39)	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92,167,273 (GRCm39)	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	92,131,752 (GRCm39)	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92,159,413 (GRCm39)	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	92,136,098 (GRCm39)	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	92,044,170 (GRCm39)	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	92,067,936 (GRCm39)	splice site	probably benign
R0632:Rasgrf2	UTSW	13	92,120,393 (GRCm39)	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	92,130,890 (GRCm39)	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92,165,174 (GRCm39)	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	92,035,808 (GRCm39)	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92,167,396 (GRCm39)	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	92,131,795 (GRCm39)	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	92,044,205 (GRCm39)	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	92,038,783 (GRCm39)	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	92,050,740 (GRCm39)	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	92,117,149 (GRCm39)	missense	probably benign
R1934:Rasgrf2	UTSW	13	92,131,825 (GRCm39)	splice site	probably null
R1990:Rasgrf2	UTSW	13	92,172,473 (GRCm39)	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	92,050,748 (GRCm39)	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92,167,351 (GRCm39)	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	92,120,374 (GRCm39)	missense	probably benign
R2193:Rasgrf2	UTSW	13	92,160,221 (GRCm39)	splice site	probably null
R2406:Rasgrf2	UTSW	13	92,120,359 (GRCm39)	missense	probably benign
R3055:Rasgrf2	UTSW	13	92,165,583 (GRCm39)	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92,167,296 (GRCm39)	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	92,130,773 (GRCm39)	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	92,038,717 (GRCm39)	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	92,038,717 (GRCm39)	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	92,033,773 (GRCm39)	nonsense	probably null
R4576:Rasgrf2	UTSW	13	92,044,529 (GRCm39)	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92,174,789 (GRCm39)	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	92,138,716 (GRCm39)	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	92,131,780 (GRCm39)	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	92,136,135 (GRCm39)	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92,160,190 (GRCm39)	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	92,044,155 (GRCm39)	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92,267,941 (GRCm39)	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	92,068,011 (GRCm39)	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92,165,609 (GRCm39)	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92,167,293 (GRCm39)	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92,267,954 (GRCm39)	missense	probably benign
R6428:Rasgrf2	UTSW	13	92,136,100 (GRCm39)	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92,167,361 (GRCm39)	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92,165,027 (GRCm39)	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	92,033,754 (GRCm39)	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	92,131,732 (GRCm39)	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	92,130,952 (GRCm39)	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92,159,100 (GRCm39)	intron	probably benign
R7056:Rasgrf2	UTSW	13	92,167,203 (GRCm39)	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	92,034,521 (GRCm39)	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	92,032,637 (GRCm39)	nonsense	probably null
R7392:Rasgrf2	UTSW	13	92,041,856 (GRCm39)	missense
R7469:Rasgrf2	UTSW	13	92,165,530 (GRCm39)	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	92,136,085 (GRCm39)	missense
R7641:Rasgrf2	UTSW	13	92,267,914 (GRCm39)	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92,267,914 (GRCm39)	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	92,044,201 (GRCm39)	missense
R7962:Rasgrf2	UTSW	13	92,167,300 (GRCm39)	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92,167,321 (GRCm39)	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	92,130,796 (GRCm39)	missense
R8796:Rasgrf2	UTSW	13	92,038,685 (GRCm39)	missense
R8913:Rasgrf2	UTSW	13	92,159,034 (GRCm39)	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92,158,225 (GRCm39)	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92,165,146 (GRCm39)	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92,267,759 (GRCm39)	missense	probably benign
R9562:Rasgrf2	UTSW	13	92,034,469 (GRCm39)	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	92,136,092 (GRCm39)	missense
R9766:Rasgrf2	UTSW	13	92,160,188 (GRCm39)	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92,267,860 (GRCm39)	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92,167,363 (GRCm39)	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	92,050,654 (GRCm39)	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	92,159,081 (GRCm39)	missense	unknown
Z1177:Rasgrf2	UTSW	13	92,131,632 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- GATGTCTGAGAGCTTTGCCAG -3'
(R):5'- AATGTCCTGGTGGTACATGG -3'

Sequencing Primer
(F):5'- TTTGCCAGCACTACGGTG -3'
(R):5'- CCTGGTGGTACATGGTGTCCC -3'

Posted On

2015-07-21