Incidental Mutation 'R4441:Nipbl'
ID 329783
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4933421G18Rik, 4921518A06Rik
MMRRC Submission 041706-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R4441 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 8320101-8473947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 8396142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 144 (Q144E)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000052965
AA Change: Q144E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: Q144E

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,127,024 (GRCm39) R1238S probably benign Het
Ankmy1 A T 1: 92,816,383 (GRCm39) Y244N possibly damaging Het
Asxl3 C T 18: 22,657,290 (GRCm39) P1767S probably damaging Het
C1qtnf7 A T 5: 43,766,612 (GRCm39) K70N possibly damaging Het
Cibar1 A G 4: 12,157,733 (GRCm39) M261T probably damaging Het
Fam78b C A 1: 166,906,491 (GRCm39) Q217K probably damaging Het
Garem1 T C 18: 21,301,807 (GRCm39) T127A possibly damaging Het
Gls A T 1: 52,235,322 (GRCm39) probably null Het
Gm12790 A C 4: 101,825,337 (GRCm39) S26A probably damaging Het
Gm136 T C 4: 34,755,911 (GRCm39) D34G probably benign Het
Gmds A G 13: 32,124,461 (GRCm39) probably null Het
Hdac9 G T 12: 34,439,375 (GRCm39) H401N probably damaging Het
Hmcn1 T C 1: 150,533,210 (GRCm39) I3026V probably null Het
Igkv6-20 A T 6: 70,313,101 (GRCm39) M24K probably damaging Het
Ilf2 T C 3: 90,394,769 (GRCm39) L339P probably benign Het
Insr T A 8: 3,244,902 (GRCm39) K501N probably benign Het
Lyst G A 13: 13,809,968 (GRCm39) R546H probably damaging Het
Mcm5 T C 8: 75,839,172 (GRCm39) S142P probably benign Het
Mcpt9 A G 14: 56,265,009 (GRCm39) V164A probably damaging Het
Ncapd3 T A 9: 26,962,941 (GRCm39) D415E possibly damaging Het
Nfia T C 4: 97,661,150 (GRCm39) probably null Het
Or51g1 A T 7: 102,633,516 (GRCm39) V285E possibly damaging Het
Or51q1c T G 7: 103,653,279 (GRCm39) F266V probably damaging Het
Or6z5 T C 7: 6,477,924 (GRCm39) S272P probably benign Het
Pcdhgb8 A G 18: 37,896,114 (GRCm39) I395V possibly damaging Het
Plcz1 T A 6: 139,936,413 (GRCm39) L605F probably benign Het
Prph G A 15: 98,955,005 (GRCm39) S325N probably damaging Het
Ptpn23 A G 9: 110,221,793 (GRCm39) M131T probably benign Het
Rab3ip T G 10: 116,751,837 (GRCm39) D278A probably benign Het
Rasgrf2 T C 13: 92,131,797 (GRCm39) D620G possibly damaging Het
Rbm5 A G 9: 107,626,887 (GRCm39) probably benign Het
Rc3h2 A G 2: 37,304,526 (GRCm39) probably null Het
Saxo5 C T 8: 3,526,105 (GRCm39) S86L probably damaging Het
Tbxa2r T C 10: 81,168,925 (GRCm39) S205P probably damaging Het
Tenm4 A G 7: 96,545,022 (GRCm39) N2375S probably benign Het
Tespa1 C T 10: 130,197,826 (GRCm39) R283C probably damaging Het
Tle2 A G 10: 81,417,516 (GRCm39) E227G possibly damaging Het
Tnik A G 3: 28,618,246 (GRCm39) I266V possibly damaging Het
Tnn T G 1: 159,943,650 (GRCm39) E1054D probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpm1 A G 7: 63,851,666 (GRCm39) D12G probably damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wdr7 T A 18: 63,888,281 (GRCm39) Y585N probably damaging Het
Zgrf1 T A 3: 127,379,786 (GRCm39) N223K possibly damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8,396,157 (GRCm39) missense probably damaging 0.98
IGL00712:Nipbl APN 15 8,398,958 (GRCm39) missense probably damaging 0.97
IGL00789:Nipbl APN 15 8,326,353 (GRCm39) missense probably damaging 1.00
IGL01025:Nipbl APN 15 8,379,939 (GRCm39) missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8,379,981 (GRCm39) missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8,340,693 (GRCm39) missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8,380,023 (GRCm39) missense probably benign
IGL01723:Nipbl APN 15 8,364,555 (GRCm39) missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8,391,305 (GRCm39) missense probably benign 0.13
IGL02398:Nipbl APN 15 8,356,574 (GRCm39) missense probably damaging 1.00
IGL02437:Nipbl APN 15 8,388,558 (GRCm39) missense probably damaging 1.00
IGL02450:Nipbl APN 15 8,373,058 (GRCm39) missense probably damaging 0.99
IGL02477:Nipbl APN 15 8,353,131 (GRCm39) splice site probably null
IGL02547:Nipbl APN 15 8,381,082 (GRCm39) missense probably benign
IGL02678:Nipbl APN 15 8,380,594 (GRCm39) missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8,325,037 (GRCm39) missense probably benign 0.34
IGL03003:Nipbl APN 15 8,379,798 (GRCm39) missense probably damaging 1.00
IGL03117:Nipbl APN 15 8,361,936 (GRCm39) missense probably damaging 1.00
IGL03162:Nipbl APN 15 8,368,463 (GRCm39) missense probably benign 0.37
IGL03224:Nipbl APN 15 8,322,569 (GRCm39) missense probably damaging 0.98
IGL03339:Nipbl APN 15 8,380,360 (GRCm39) missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8,380,216 (GRCm39) missense probably benign
R3620_nipbl_616 UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R0271:Nipbl UTSW 15 8,391,221 (GRCm39) missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347:Nipbl UTSW 15 8,380,216 (GRCm39) missense probably benign
R0422:Nipbl UTSW 15 8,381,112 (GRCm39) missense probably benign
R0486:Nipbl UTSW 15 8,368,354 (GRCm39) splice site probably benign
R0652:Nipbl UTSW 15 8,332,964 (GRCm39) missense probably benign 0.23
R0667:Nipbl UTSW 15 8,390,488 (GRCm39) missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8,322,562 (GRCm39) splice site probably null
R0726:Nipbl UTSW 15 8,381,039 (GRCm39) missense probably benign
R0881:Nipbl UTSW 15 8,337,096 (GRCm39) missense probably damaging 0.98
R0904:Nipbl UTSW 15 8,391,202 (GRCm39) missense probably benign
R0969:Nipbl UTSW 15 8,321,712 (GRCm39) missense probably damaging 1.00
R1401:Nipbl UTSW 15 8,401,657 (GRCm39) missense probably damaging 0.97
R1479:Nipbl UTSW 15 8,379,773 (GRCm39) missense probably benign 0.00
R1495:Nipbl UTSW 15 8,380,764 (GRCm39) missense probably benign 0.00
R1609:Nipbl UTSW 15 8,396,148 (GRCm39) missense probably damaging 1.00
R1679:Nipbl UTSW 15 8,332,396 (GRCm39) missense probably benign 0.31
R1756:Nipbl UTSW 15 8,368,035 (GRCm39) missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8,348,972 (GRCm39) missense probably damaging 1.00
R1835:Nipbl UTSW 15 8,373,001 (GRCm39) missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8,356,616 (GRCm39) missense probably damaging 1.00
R1914:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8,379,771 (GRCm39) missense probably damaging 1.00
R2046:Nipbl UTSW 15 8,353,951 (GRCm39) missense probably benign 0.08
R2076:Nipbl UTSW 15 8,340,691 (GRCm39) missense probably benign 0.11
R2163:Nipbl UTSW 15 8,366,403 (GRCm39) missense probably damaging 0.99
R2170:Nipbl UTSW 15 8,322,702 (GRCm39) missense probably damaging 1.00
R2425:Nipbl UTSW 15 8,380,966 (GRCm39) missense probably benign 0.06
R2475:Nipbl UTSW 15 8,364,490 (GRCm39) missense probably benign 0.05
R2484:Nipbl UTSW 15 8,353,182 (GRCm39) missense probably damaging 0.99
R2970:Nipbl UTSW 15 8,340,723 (GRCm39) missense probably damaging 1.00
R3116:Nipbl UTSW 15 8,373,076 (GRCm39) missense probably benign 0.00
R3620:Nipbl UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R3725:Nipbl UTSW 15 8,325,145 (GRCm39) missense probably damaging 0.97
R3745:Nipbl UTSW 15 8,388,358 (GRCm39) missense probably benign
R3902:Nipbl UTSW 15 8,379,730 (GRCm39) missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8,380,018 (GRCm39) missense probably benign
R4164:Nipbl UTSW 15 8,368,418 (GRCm39) missense probably benign 0.24
R4246:Nipbl UTSW 15 8,361,916 (GRCm39) missense probably damaging 1.00
R4381:Nipbl UTSW 15 8,388,690 (GRCm39) missense probably benign 0.00
R4394:Nipbl UTSW 15 8,391,345 (GRCm39) missense probably benign 0.00
R4439:Nipbl UTSW 15 8,368,208 (GRCm39) missense probably damaging 0.98
R4440:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4672:Nipbl UTSW 15 8,332,468 (GRCm39) missense probably damaging 1.00
R4749:Nipbl UTSW 15 8,395,313 (GRCm39) missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8,380,981 (GRCm39) missense probably benign
R5428:Nipbl UTSW 15 8,359,780 (GRCm39) missense probably benign 0.00
R5641:Nipbl UTSW 15 8,396,196 (GRCm39) missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5644:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5681:Nipbl UTSW 15 8,330,866 (GRCm39) missense probably benign 0.22
R5741:Nipbl UTSW 15 8,354,133 (GRCm39) missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8,364,328 (GRCm39) splice site probably null
R5970:Nipbl UTSW 15 8,326,302 (GRCm39) missense probably benign 0.27
R6041:Nipbl UTSW 15 8,353,748 (GRCm39) missense probably damaging 1.00
R6059:Nipbl UTSW 15 8,325,052 (GRCm39) missense probably damaging 1.00
R6213:Nipbl UTSW 15 8,364,390 (GRCm39) missense probably damaging 1.00
R6216:Nipbl UTSW 15 8,347,867 (GRCm39) missense probably damaging 0.99
R6236:Nipbl UTSW 15 8,354,064 (GRCm39) missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R6427:Nipbl UTSW 15 8,381,049 (GRCm39) missense probably benign
R6707:Nipbl UTSW 15 8,354,043 (GRCm39) missense probably benign 0.01
R6731:Nipbl UTSW 15 8,352,074 (GRCm39) missense probably damaging 1.00
R6921:Nipbl UTSW 15 8,332,969 (GRCm39) missense probably benign 0.28
R7239:Nipbl UTSW 15 8,321,619 (GRCm39) critical splice donor site probably null
R7346:Nipbl UTSW 15 8,373,090 (GRCm39) missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8,359,779 (GRCm39) missense probably benign 0.01
R7486:Nipbl UTSW 15 8,325,120 (GRCm39) missense probably benign 0.25
R7598:Nipbl UTSW 15 8,372,977 (GRCm39) missense probably benign 0.24
R7609:Nipbl UTSW 15 8,335,356 (GRCm39) missense probably benign 0.27
R7674:Nipbl UTSW 15 8,322,585 (GRCm39) missense probably benign 0.15
R7706:Nipbl UTSW 15 8,381,010 (GRCm39) missense probably benign 0.01
R7760:Nipbl UTSW 15 8,388,186 (GRCm39) missense probably damaging 1.00
R7766:Nipbl UTSW 15 8,326,333 (GRCm39) missense probably benign 0.45
R7825:Nipbl UTSW 15 8,320,971 (GRCm39) missense probably damaging 1.00
R7862:Nipbl UTSW 15 8,355,236 (GRCm39) missense probably benign 0.06
R7958:Nipbl UTSW 15 8,340,742 (GRCm39) missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8,340,734 (GRCm39) missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8,388,696 (GRCm39) missense probably benign 0.22
R8355:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8441:Nipbl UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R8455:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8717:Nipbl UTSW 15 8,368,225 (GRCm39) missense probably benign
R8739:Nipbl UTSW 15 8,332,904 (GRCm39) missense probably benign 0.08
R8854:Nipbl UTSW 15 8,330,210 (GRCm39) missense probably damaging 1.00
R8887:Nipbl UTSW 15 8,391,271 (GRCm39) missense probably damaging 1.00
R8942:Nipbl UTSW 15 8,381,104 (GRCm39) missense probably benign
R8991:Nipbl UTSW 15 8,320,997 (GRCm39) missense probably damaging 1.00
R9008:Nipbl UTSW 15 8,356,608 (GRCm39) missense probably damaging 1.00
R9070:Nipbl UTSW 15 8,368,215 (GRCm39) missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8,380,340 (GRCm39) missense probably benign 0.00
R9622:Nipbl UTSW 15 8,366,373 (GRCm39) missense probably benign 0.27
R9778:Nipbl UTSW 15 8,321,032 (GRCm39) missense probably benign 0.10
RF020:Nipbl UTSW 15 8,388,418 (GRCm39) missense probably damaging 0.98
X0022:Nipbl UTSW 15 8,381,199 (GRCm39) missense probably benign 0.05
X0027:Nipbl UTSW 15 8,353,021 (GRCm39) missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8,337,366 (GRCm39) missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8,368,183 (GRCm39) missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8,368,164 (GRCm39) critical splice donor site probably null
Z1177:Nipbl UTSW 15 8,366,436 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGTGCTGCTGTGAATTAACC -3'
(R):5'- TGCTAGTAGCTATATATTGCTTCCC -3'

Sequencing Primer
(F):5'- TTAGGCAAGCATTCTGCCAG -3'
(R):5'- CAAACAAAATCATTCTGGTAGAACAG -3'
Posted On 2015-07-21