Incidental Mutation 'R4444:Spc25'
ID329793
Institutional Source Beutler Lab
Gene Symbol Spc25
Ensembl Gene ENSMUSG00000005233
Gene NameSPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms2600017H08Rik, Spbc25, 2610205L13Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69193895-69206194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69204876 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 47 (M47K)
Ref Sequence ENSEMBL: ENSMUSP00000120142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005365] [ENSMUST00000112320] [ENSMUST00000127243] [ENSMUST00000149045] [ENSMUST00000149643] [ENSMUST00000167875]
Predicted Effect probably benign
Transcript: ENSMUST00000005365
AA Change: M62K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000005365
Gene: ENSMUSG00000005233
AA Change: M62K

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 148 222 6.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112320
AA Change: M62K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000107939
Gene: ENSMUSG00000005233
AA Change: M62K

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 150 221 1.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126638
Predicted Effect probably benign
Transcript: ENSMUST00000127243
AA Change: M47K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120142
Gene: ENSMUSG00000005233
AA Change: M47K

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
coiled coil region 57 113 N/A INTRINSIC
Pfam:Spindle_Spc25 133 207 4.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149045
AA Change: M14K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000120999
Gene: ENSMUSG00000005233
AA Change: M14K

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 133 3.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149401
Predicted Effect probably benign
Transcript: ENSMUST00000149643
AA Change: M62K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000117415
Gene: ENSMUSG00000005233
AA Change: M62K

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3IZ0|E 99 167 3e-22 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150505
Predicted Effect probably benign
Transcript: ENSMUST00000167875
AA Change: M14K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128039
Gene: ENSMUSG00000005233
AA Change: M14K

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 174 1.7e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Gemin4 A G 11: 76,212,091 F615L probably benign Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Hunk C T 16: 90,432,791 A180V probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Retreg1 T G 15: 25,968,444 probably null Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Rpl9-ps1 T C 11: 83,645,381 I81V possibly damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Spc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Spc25 APN 2 69202608 nonsense probably null
IGL02273:Spc25 APN 2 69204929 splice site probably benign
IGL03163:Spc25 APN 2 69197204 missense probably damaging 1.00
R1519:Spc25 UTSW 2 69200087 missense probably damaging 1.00
R1604:Spc25 UTSW 2 69205154 missense probably damaging 0.99
R2913:Spc25 UTSW 2 69199987 missense probably benign 0.42
R3973:Spc25 UTSW 2 69202601 missense probably damaging 1.00
R4094:Spc25 UTSW 2 69202631 missense probably damaging 1.00
R5293:Spc25 UTSW 2 69202652 missense possibly damaging 0.92
R6242:Spc25 UTSW 2 69197211 missense probably damaging 1.00
R6433:Spc25 UTSW 2 69206102 utr 5 prime probably benign
R6721:Spc25 UTSW 2 69197173 missense possibly damaging 0.96
R7712:Spc25 UTSW 2 69206137 missense unknown
R7866:Spc25 UTSW 2 69206062 critical splice donor site probably null
R7949:Spc25 UTSW 2 69206062 critical splice donor site probably null
R8054:Spc25 UTSW 2 69204913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTTTAAGCTGGTGATAGGAAC -3'
(R):5'- AGGACTCCATGAAAGCGTTTTC -3'

Sequencing Primer
(F):5'- ATAGGAATTGAACCTGGGTCCTC -3'
(R):5'- GTACTGCCAGCCCTTAA -3'
Posted On2015-07-21