Mutagenetix > Incidental Mutation

Incidental Mutation 'R4444:Spc25'

329793

Institutional Source

Beutler Lab

Gene Symbol

Spc25

Ensembl Gene

ENSMUSG00000005233

Gene Name

SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)

Synonyms

2600017H08Rik, 2610205L13Rik, Spbc25

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R4444 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69024239-69036538 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69035220 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 47 (M47K)

Ref Sequence

ENSEMBL: ENSMUSP00000120142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005365] [ENSMUST00000112320] [ENSMUST00000127243] [ENSMUST00000149045] [ENSMUST00000149643] [ENSMUST00000167875]

AlphaFold

Q3UA16

Predicted Effect

probably benign
Transcript: ENSMUST00000005365
AA Change: M62K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000005365
Gene: ENSMUSG00000005233
AA Change: M62K

Domain	Start	End	E-Value	Type
low complexity region	46	57	N/A	INTRINSIC
Pfam:Spindle_Spc25	148	222	6.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112320
AA Change: M62K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000107939
Gene: ENSMUSG00000005233
AA Change: M62K

Domain	Start	End	E-Value	Type
low complexity region	46	57	N/A	INTRINSIC
Pfam:Spindle_Spc25	150	221	1.3e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126638

Predicted Effect

probably benign
Transcript: ENSMUST00000127243
AA Change: M47K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000120142
Gene: ENSMUSG00000005233
AA Change: M47K

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC
low complexity region	30	44	N/A	INTRINSIC
coiled coil region	57	113	N/A	INTRINSIC
Pfam:Spindle_Spc25	133	207	4.5e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149045
AA Change: M14K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000120999
Gene: ENSMUSG00000005233
AA Change: M14K

Domain	Start	End	E-Value	Type
Pfam:Spindle_Spc25	100	133	3.7e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149401

Predicted Effect

probably benign
Transcript: ENSMUST00000149643
AA Change: M62K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000117415
Gene: ENSMUSG00000005233
AA Change: M62K

Domain	Start	End	E-Value	Type
low complexity region	46	57	N/A	INTRINSIC
PDB:3IZ0\|E	99	167	3e-22	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000167875
AA Change: M14K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000128039
Gene: ENSMUSG00000005233
AA Change: M14K

Domain	Start	End	E-Value	Type
Pfam:Spindle_Spc25	100	174	1.7e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150505

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	G	T	7: 45,785,618 (GRCm39)	T695N	probably benign	Het
Cdkl2	G	A	5: 92,168,168 (GRCm39)	T342I	probably benign	Het
Cntn5	C	A	9: 9,704,947 (GRCm39)	E822D	probably damaging	Het
Cysltr2	G	A	14: 73,267,333 (GRCm39)	H126Y	possibly damaging	Het
Dlg2	T	C	7: 91,737,801 (GRCm39)	S428P	probably damaging	Het
Egfr	A	G	11: 16,821,027 (GRCm39)	D314G	probably benign	Het
Ercc5	GAAAA	GAAAAA	1: 44,197,369 (GRCm39)		probably null	Het
Gemin4	A	G	11: 76,102,917 (GRCm39)	F615L	probably benign	Het
Ggn	A	G	7: 28,871,585 (GRCm39)	T322A	probably benign	Het
Hunk	C	T	16: 90,229,679 (GRCm39)	A180V	probably benign	Het
Kalrn	C	T	16: 33,810,180 (GRCm39)	D2525N	possibly damaging	Het
Myo1b	A	T	1: 51,797,078 (GRCm39)	I988N	probably damaging	Het
Nlrp4e	A	G	7: 23,020,652 (GRCm39)	I380V	probably benign	Het
Or2ag1b	T	A	7: 106,288,353 (GRCm39)	Y195F	possibly damaging	Het
Plb1	G	A	5: 32,487,909 (GRCm39)	V930I	probably benign	Het
Plxna2	C	T	1: 194,431,625 (GRCm39)	S538F	probably damaging	Het
Retreg1	T	G	15: 25,968,530 (GRCm39)		probably null	Het
Rnf13	A	C	3: 57,728,010 (GRCm39)	K230T	probably damaging	Het
Rpl9-ps1	T	C	11: 83,536,207 (GRCm39)	I81V	possibly damaging	Het
Slco1c1	A	G	6: 141,492,417 (GRCm39)	T267A	possibly damaging	Het
Syne2	A	G	12: 76,069,804 (GRCm39)	E4377G	probably damaging	Het
Usp34	A	G	11: 23,385,998 (GRCm39)	T2142A	probably damaging	Het
Zc3h7a	A	G	16: 10,968,457 (GRCm39)		probably null	Het
Zfp169	T	A	13: 48,643,813 (GRCm39)	K438M	possibly damaging	Het

Other mutations in Spc25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01757:Spc25	APN	2	69,032,952 (GRCm39)	nonsense	probably null
IGL02273:Spc25	APN	2	69,035,273 (GRCm39)	splice site	probably benign
IGL03163:Spc25	APN	2	69,027,548 (GRCm39)	missense	probably damaging	1.00
R1519:Spc25	UTSW	2	69,030,431 (GRCm39)	missense	probably damaging	1.00
R1604:Spc25	UTSW	2	69,035,498 (GRCm39)	missense	probably damaging	0.99
R2913:Spc25	UTSW	2	69,030,331 (GRCm39)	missense	probably benign	0.42
R3973:Spc25	UTSW	2	69,032,945 (GRCm39)	missense	probably damaging	1.00
R4094:Spc25	UTSW	2	69,032,975 (GRCm39)	missense	probably damaging	1.00
R5293:Spc25	UTSW	2	69,032,996 (GRCm39)	missense	possibly damaging	0.92
R6242:Spc25	UTSW	2	69,027,555 (GRCm39)	missense	probably damaging	1.00
R6433:Spc25	UTSW	2	69,036,446 (GRCm39)	utr 5 prime	probably benign
R6721:Spc25	UTSW	2	69,027,517 (GRCm39)	missense	possibly damaging	0.96
R7712:Spc25	UTSW	2	69,036,481 (GRCm39)	missense	unknown
R7866:Spc25	UTSW	2	69,036,406 (GRCm39)	critical splice donor site	probably null
R8054:Spc25	UTSW	2	69,035,257 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAACTTTAAGCTGGTGATAGGAAC -3'
(R):5'- AGGACTCCATGAAAGCGTTTTC -3'

Sequencing Primer
(F):5'- ATAGGAATTGAACCTGGGTCCTC -3'
(R):5'- GTACTGCCAGCCCTTAA -3'

Posted On

2015-07-21