Incidental Mutation 'R4444:Rnf13'
ID329794
Institutional Source Beutler Lab
Gene Symbol Rnf13
Ensembl Gene ENSMUSG00000036503
Gene Namering finger protein 13
Synonyms2010001H16Rik, Rzf
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location57736062-57835233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 57820589 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 230 (K230T)
Ref Sequence ENSEMBL: ENSMUSP00000142335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041826] [ENSMUST00000197205] [ENSMUST00000198214] [ENSMUST00000199041] [ENSMUST00000200497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041826
AA Change: K230T

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049331
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 63 160 1.3e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
RING 240 281 1.85e-8 SMART
low complexity region 291 299 N/A INTRINSIC
low complexity region 336 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197205
SMART Domains Protein: ENSMUSP00000143692
Gene: ENSMUSG00000036503

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:PA 62 153 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197920
Predicted Effect probably damaging
Transcript: ENSMUST00000198214
AA Change: K230T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143498
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 63 160 5.1e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199041
AA Change: K230T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142335
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 59 162 6.6e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 2e-7 SMART
Blast:RING 240 267 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200497
AA Change: K230T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142462
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 59 162 1.1e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 1e-7 SMART
Blast:RING 240 261 9e-8 BLAST
low complexity region 262 270 N/A INTRINSIC
low complexity region 307 328 N/A INTRINSIC
Meta Mutation Damage Score 0.1522 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the PA-TM-RING family of proteins that contain a protease associated (PA) domain and a RING finger domain separated by a transmembrane (TM) domain. The encoded protein is an E3 ubiquitin ligase localized to the endosomal-lysosomal vesicles and inner nuclear membrane. Mice lacking the encoded protein have impaired learning abilities associated with a decreased synaptic vesicle density and dysregulated SNARE complex assembly. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on the X chromosome. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Gemin4 A G 11: 76,212,091 F615L probably benign Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Hunk C T 16: 90,432,791 A180V probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Retreg1 T G 15: 25,968,444 probably null Het
Rpl9-ps1 T C 11: 83,645,381 I81V possibly damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Spc25 A T 2: 69,204,876 M47K probably benign Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Rnf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Rnf13 APN 3 57807087 missense probably benign 0.06
IGL01835:Rnf13 APN 3 57820586 missense probably damaging 1.00
IGL02219:Rnf13 APN 3 57796223 missense probably damaging 1.00
IGL02675:Rnf13 APN 3 57779396 missense probably benign 0.17
IGL03015:Rnf13 APN 3 57833744 missense possibly damaging 0.74
IGL03246:Rnf13 APN 3 57769050 missense probably damaging 0.98
solomon UTSW 3 57820534 nonsense probably null
BB005:Rnf13 UTSW 3 57764308 missense not run
BB015:Rnf13 UTSW 3 57764308 missense not run
R0147:Rnf13 UTSW 3 57802468 missense probably damaging 0.98
R0481:Rnf13 UTSW 3 57779451 missense probably damaging 1.00
R0481:Rnf13 UTSW 3 57807053 missense probably damaging 1.00
R1389:Rnf13 UTSW 3 57779496 missense probably damaging 1.00
R2146:Rnf13 UTSW 3 57802486 missense probably null 0.99
R3964:Rnf13 UTSW 3 57769112 missense probably damaging 0.96
R4446:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4489:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4810:Rnf13 UTSW 3 57796272 missense probably damaging 0.99
R4940:Rnf13 UTSW 3 57796206 missense probably damaging 0.98
R6233:Rnf13 UTSW 3 57832970 missense possibly damaging 0.83
R7002:Rnf13 UTSW 3 57833612 missense probably damaging 0.96
R7622:Rnf13 UTSW 3 57820534 nonsense probably null
R7652:Rnf13 UTSW 3 57764351 missense probably benign 0.01
R8011:Rnf13 UTSW 3 57807070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGTTTTACAGCATCTATCCAG -3'
(R):5'- TGGTGGCAATGTATATTTCTCCCC -3'

Sequencing Primer
(F):5'- CTTTCCATCTTTAGATCACAAA -3'
(R):5'- CCTTTACCAGGCTACCAGTAC -3'
Posted On2015-07-21