Incidental Mutation 'R4444:Cdkl2'
ID329795
Institutional Source Beutler Lab
Gene Symbol Cdkl2
Ensembl Gene ENSMUSG00000029403
Gene Namecyclin-dependent kinase-like 2 (CDC2-related kinase)
Synonyms5330436L21Rik, KKIAMRE, Kkm
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92006074-92043883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92020309 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 342 (T342I)
Ref Sequence ENSEMBL: ENSMUSP00000108768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069937] [ENSMUST00000086978] [ENSMUST00000113140] [ENSMUST00000113143]
Predicted Effect probably benign
Transcript: ENSMUST00000069937
AA Change: T342I

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063617
Gene: ENSMUSG00000029403
AA Change: T342I

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086978
AA Change: T342I

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084199
Gene: ENSMUSG00000029403
AA Change: T342I

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113140
AA Change: T342I

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108765
Gene: ENSMUSG00000029403
AA Change: T342I

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113143
AA Change: T342I

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108768
Gene: ENSMUSG00000029403
AA Change: T342I

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136037
Predicted Effect probably benign
Transcript: ENSMUST00000201357
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the cytoplasm, with lower levels in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Gemin4 A G 11: 76,212,091 F615L probably benign Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Hunk C T 16: 90,432,791 A180V probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Retreg1 T G 15: 25,968,444 probably null Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Rpl9-ps1 T C 11: 83,645,381 I81V possibly damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Spc25 A T 2: 69,204,876 M47K probably benign Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Cdkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Cdkl2 APN 5 92017377 splice site probably null
IGL02481:Cdkl2 APN 5 92037271 missense probably damaging 1.00
IGL02943:Cdkl2 APN 5 92037244 missense possibly damaging 0.81
IGL03187:Cdkl2 APN 5 92017380 critical splice donor site probably null
IGL03251:Cdkl2 APN 5 92033726 missense probably damaging 1.00
R0422:Cdkl2 UTSW 5 92020312 missense probably benign 0.02
R0616:Cdkl2 UTSW 5 92009004 missense probably benign 0.12
R0764:Cdkl2 UTSW 5 92020277 missense probably benign 0.00
R1023:Cdkl2 UTSW 5 92039286 missense possibly damaging 0.58
R2338:Cdkl2 UTSW 5 92033679 missense possibly damaging 0.92
R2497:Cdkl2 UTSW 5 92008998 missense probably benign 0.44
R3926:Cdkl2 UTSW 5 92033139 missense possibly damaging 0.62
R4445:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4446:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4647:Cdkl2 UTSW 5 92017213 missense probably damaging 0.99
R4664:Cdkl2 UTSW 5 92037265 missense probably damaging 0.99
R5478:Cdkl2 UTSW 5 92039249 nonsense probably null
R5636:Cdkl2 UTSW 5 92033742 missense probably benign 0.01
R6446:Cdkl2 UTSW 5 92033217 missense probably damaging 1.00
R7051:Cdkl2 UTSW 5 92033225 missense probably damaging 0.99
R7096:Cdkl2 UTSW 5 92033184 nonsense probably null
R7388:Cdkl2 UTSW 5 92019459 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTGCTGCAATCTCTGAGGC -3'
(R):5'- ACGTATACTCTTGGACACAGAC -3'

Sequencing Primer
(F):5'- CTGGTGGAAGCCAAGCCTTTG -3'
(R):5'- GTATACTCTTGGACACAGACAGATC -3'
Posted On2015-07-21