Incidental Mutation 'R4444:Gemin4'
ID329807
Institutional Source Beutler Lab
Gene Symbol Gemin4
Ensembl Gene ENSMUSG00000049396
Gene Namegem nuclear organelle associated protein 4
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location76210571-76217664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76212091 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 615 (F615L)
Ref Sequence ENSEMBL: ENSMUSP00000099558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094014] [ENSMUST00000102500] [ENSMUST00000129853] [ENSMUST00000169560] [ENSMUST00000169701]
Predicted Effect probably benign
Transcript: ENSMUST00000094014
SMART Domains Protein: ENSMUSP00000091553
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 249 7.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102500
AA Change: F615L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127340
Predicted Effect probably benign
Transcript: ENSMUST00000129853
SMART Domains Protein: ENSMUSP00000114936
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
TLC 1 166 6.2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably benign
Transcript: ENSMUST00000169560
SMART Domains Protein: ENSMUSP00000131151
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 217 4.92e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169701
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Hunk C T 16: 90,432,791 A180V probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Retreg1 T G 15: 25,968,444 probably null Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Rpl9-ps1 T C 11: 83,645,381 I81V possibly damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Spc25 A T 2: 69,204,876 M47K probably benign Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Gemin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Gemin4 APN 11 76213485 missense probably benign 0.16
IGL01654:Gemin4 APN 11 76213398 missense probably damaging 1.00
IGL01656:Gemin4 APN 11 76213810 missense probably damaging 1.00
IGL02890:Gemin4 APN 11 76211264 missense probably damaging 1.00
IGL02967:Gemin4 APN 11 76212241 missense probably damaging 1.00
R0359:Gemin4 UTSW 11 76212162 missense probably benign 0.02
R0413:Gemin4 UTSW 11 76211322 missense probably benign 0.00
R1538:Gemin4 UTSW 11 76211161 missense probably benign 0.00
R1632:Gemin4 UTSW 11 76210989 missense probably benign 0.26
R1762:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1783:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1784:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1785:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1786:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1835:Gemin4 UTSW 11 76213296 missense possibly damaging 0.62
R2007:Gemin4 UTSW 11 76212618 missense possibly damaging 0.78
R2117:Gemin4 UTSW 11 76211001 missense possibly damaging 0.59
R2131:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2133:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2140:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2141:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2142:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R3937:Gemin4 UTSW 11 76212888 missense probably damaging 1.00
R4112:Gemin4 UTSW 11 76212819 missense probably damaging 0.99
R5502:Gemin4 UTSW 11 76213401 nonsense probably null
R5702:Gemin4 UTSW 11 76210837 missense probably benign 0.01
R5744:Gemin4 UTSW 11 76212165 missense probably damaging 1.00
R6044:Gemin4 UTSW 11 76212934 missense probably benign
R6924:Gemin4 UTSW 11 76212336 missense probably damaging 1.00
R6931:Gemin4 UTSW 11 76210956 missense probably damaging 0.99
R7278:Gemin4 UTSW 11 76212106 missense probably damaging 0.98
R7286:Gemin4 UTSW 11 76212753 missense probably damaging 0.96
R7288:Gemin4 UTSW 11 76213380 missense possibly damaging 0.60
R7358:Gemin4 UTSW 11 76213452 nonsense probably null
R7572:Gemin4 UTSW 11 76213582 missense probably damaging 1.00
R8132:Gemin4 UTSW 11 76212913 missense probably benign 0.25
Z1176:Gemin4 UTSW 11 76217579 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATACTCTTCCAGGCCTGCATTG -3'
(R):5'- TCCTGAACCCAGAAGTTGTGG -3'

Sequencing Primer
(F):5'- CGAGGGTCTGGATGAAGAGCTTC -3'
(R):5'- CTGAACCCAGAAGTTGTGGTGAAG -3'
Posted On2015-07-21