Incidental Mutation 'R4444:Rpl9-ps1'
ID329808
Institutional Source Beutler Lab
Gene Symbol Rpl9-ps1
Ensembl Gene ENSMUSG00000081906
Gene Nameribosomal protein L9, pseudogene 1
SynonymsGm11436
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83645046-83645621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83645381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 81 (I81V)
Ref Sequence ENSEMBL: ENSMUSP00000138342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001008] [ENSMUST00000182502]
Predicted Effect probably benign
Transcript: ENSMUST00000001008
SMART Domains Protein: ENSMUSP00000001008
Gene: ENSMUSG00000000982

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 31 88 2.25e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117199
Predicted Effect possibly damaging
Transcript: ENSMUST00000182502
AA Change: I81V

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138342
Gene: ENSMUSG00000081906
AA Change: I81V

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.2e-16 PFAM
Pfam:Ribosomal_L6 119 177 6.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Gemin4 A G 11: 76,212,091 F615L probably benign Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Hunk C T 16: 90,432,791 A180V probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Retreg1 T G 15: 25,968,444 probably null Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Spc25 A T 2: 69,204,876 M47K probably benign Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Rpl9-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7651:Rpl9-ps1 UTSW 11 83645085 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGGCTGAATTTGAAACAAGTTC -3'
(R):5'- AGTCATTATGAAGGGCCCCAG -3'

Sequencing Primer
(F):5'- ATTCTTCTGGGCTTGAGAGACAGAAC -3'
(R):5'- CAGGGGGACTCTGCAGAGG -3'
Posted On2015-07-21