Incidental Mutation 'R4444:Cysltr2'
ID329813
Institutional Source Beutler Lab
Gene Symbol Cysltr2
Ensembl Gene ENSMUSG00000033470
Gene Namecysteinyl leukotriene receptor 2
SynonymsCYSLT2R, 2300001H05Rik, Cyslt2, CysLT2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73025603-73049114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73029893 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 126 (H126Y)
Ref Sequence ENSEMBL: ENSMUSP00000125958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044664] [ENSMUST00000169168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044664
AA Change: H126Y

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040715
Gene: ENSMUSG00000033470
AA Change: H126Y

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.6e-8 PFAM
Pfam:7tm_1 39 289 2.5e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169168
AA Change: H126Y

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125958
Gene: ENSMUSG00000033470
AA Change: H126Y

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.4e-8 PFAM
Pfam:7tm_1 39 289 1.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228154
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cysteinyl leukotrienes LTC4, LTD4, and LTE4 are important mediators of human bronchial asthma. Pharmacologic studies have determined that cysteinyl leukotrienes activate at least 2 receptors, the protein encoded by this gene and CYSLTR1. This encoded receptor is a member of the superfamily of G protein-coupled receptors. It seems to play a major role in endocrine and cardiovascular systems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced bleomycin-induced pulmonary fibrosis and reduced IgE dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Gemin4 A G 11: 76,212,091 F615L probably benign Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Hunk C T 16: 90,432,791 A180V probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Retreg1 T G 15: 25,968,444 probably null Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Rpl9-ps1 T C 11: 83,645,381 I81V possibly damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Spc25 A T 2: 69,204,876 M47K probably benign Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Cysltr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03211:Cysltr2 APN 14 73029715 missense possibly damaging 0.90
R1223:Cysltr2 UTSW 14 73030099 missense probably damaging 1.00
R1689:Cysltr2 UTSW 14 73030030 missense possibly damaging 0.75
R1695:Cysltr2 UTSW 14 73029881 missense probably benign 0.01
R1898:Cysltr2 UTSW 14 73029533 missense probably damaging 1.00
R3968:Cysltr2 UTSW 14 73030174 missense probably damaging 0.99
R4013:Cysltr2 UTSW 14 73029565 missense probably damaging 1.00
R4357:Cysltr2 UTSW 14 73029644 missense probably benign 0.15
R4445:Cysltr2 UTSW 14 73029893 missense possibly damaging 0.74
R5207:Cysltr2 UTSW 14 73029511 missense probably damaging 0.99
R5591:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5592:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5593:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5839:Cysltr2 UTSW 14 73030183 missense probably damaging 1.00
R5885:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5886:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5934:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029949 missense probably damaging 1.00
R7775:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
R7778:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
R7824:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
X0009:Cysltr2 UTSW 14 73029979 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTACTGCAATGTGGTTCATG -3'
(R):5'- ATGTTTTCATGCTCAACCTGG -3'

Sequencing Primer
(F):5'- CTACTGCAATGTGGTTCATGATCAG -3'
(R):5'- CAACCTGGCCACTTCCG -3'
Posted On2015-07-21