Incidental Mutation 'R4444:Retreg1'
ID329814
Institutional Source Beutler Lab
Gene Symbol Retreg1
Ensembl Gene ENSMUSG00000022270
Gene Namereticulophagy regulator 1
Synonyms1810015C04Rik, Fam134b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location25843180-25973687 bp(+) (GRCm38)
Type of Mutationunclassified (1752 bp from exon)
DNA Base Change (assembly) T to G at 25968444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022881] [ENSMUST00000110438] [ENSMUST00000226438] [ENSMUST00000226750] [ENSMUST00000227275] [ENSMUST00000228306] [ENSMUST00000228327] [ENSMUST00000228600]
Predicted Effect probably damaging
Transcript: ENSMUST00000022881
AA Change: N219K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022881
Gene: ENSMUSG00000022270
AA Change: N219K

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110438
AA Change: N95K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106068
Gene: ENSMUSG00000022270
AA Change: N95K

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226438
AA Change: N103K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000226750
Predicted Effect probably damaging
Transcript: ENSMUST00000227275
AA Change: N95K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228306
AA Change: N85K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228327
AA Change: N61K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000228600
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cis-Golgi transmembrane protein that may be necessary for the long-term survival of nociceptive and autonomic ganglion neurons. Mutations in this gene are a cause of hereditary sensory and autonomic neuropathy type IIB (HSAN IIB), and this gene may also play a role in susceptibility to vascular dementia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thermal nociceptive threshold and sensory neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Gemin4 A G 11: 76,212,091 F615L probably benign Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Hunk C T 16: 90,432,791 A180V probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Rpl9-ps1 T C 11: 83,645,381 I81V possibly damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Spc25 A T 2: 69,204,876 M47K probably benign Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Retreg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Retreg1 APN 15 25966623 unclassified probably null
IGL02548:Retreg1 APN 15 25895118 nonsense probably null
R0834:Retreg1 UTSW 15 25971670 missense probably benign 0.01
R1923:Retreg1 UTSW 15 25969838 missense probably damaging 1.00
R1965:Retreg1 UTSW 15 25970164 missense probably damaging 1.00
R4529:Retreg1 UTSW 15 25968514 missense probably damaging 1.00
R4778:Retreg1 UTSW 15 25971785 missense possibly damaging 0.60
R5026:Retreg1 UTSW 15 25970128 missense probably damaging 1.00
R5103:Retreg1 UTSW 15 25968454 nonsense probably null
R6880:Retreg1 UTSW 15 25971739 missense probably damaging 1.00
R7275:Retreg1 UTSW 15 25971598 missense probably benign 0.44
R7357:Retreg1 UTSW 15 25971943 missense probably damaging 0.97
R7488:Retreg1 UTSW 15 25889542 missense
R7542:Retreg1 UTSW 15 25941210 start codon destroyed probably null 0.10
R7599:Retreg1 UTSW 15 25971641 missense probably benign 0.04
R7670:Retreg1 UTSW 15 25941040 intron probably benign
R8022:Retreg1 UTSW 15 25843479 missense
R8084:Retreg1 UTSW 15 25969799 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAGCCGGGGACAGTGGTTATAG -3'
(R):5'- GGAAAGACTACTCAGATTACACAGG -3'

Sequencing Primer
(F):5'- GGACAGTGGTTATAGGTTTTTATGG -3'
(R):5'- AGACCTACCAGATCTCTCAC -3'
Posted On2015-07-21