Incidental Mutation 'R4444:Hunk'
ID329817
Institutional Source Beutler Lab
Gene Symbol Hunk
Ensembl Gene ENSMUSG00000053414
Gene Namehormonally upregulated Neu-associated kinase
SynonymsBstk1, Mak-v
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4444 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location90386013-90499553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90432791 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 180 (A180V)
Ref Sequence ENSEMBL: ENSMUSP00000068007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065856] [ENSMUST00000231719]
Predicted Effect probably benign
Transcript: ENSMUST00000065856
AA Change: A180V

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068007
Gene: ENSMUSG00000053414
AA Change: A180V

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
S_TKc 62 320 8.72e-97 SMART
low complexity region 521 534 N/A INTRINSIC
low complexity region 599 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231719
AA Change: A104V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene result in no abnormal phenotype, however in combination with Tg(MMTV-Myc)Led mice, metastatic potential of mammary tumors is decreased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,136,194 T695N probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cntn5 C A 9: 9,704,942 E822D probably damaging Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Dlg2 T C 7: 92,088,593 S428P probably damaging Het
Egfr A G 11: 16,871,027 D314G probably benign Het
Ercc5 GAAAA GAAAAA 1: 44,158,209 probably null Het
Gemin4 A G 11: 76,212,091 F615L probably benign Het
Ggn A G 7: 29,172,160 T322A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Myo1b A T 1: 51,757,919 I988N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Plb1 G A 5: 32,330,565 V930I probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Retreg1 T G 15: 25,968,444 probably null Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Rpl9-ps1 T C 11: 83,645,381 I81V possibly damaging Het
Slco1c1 A G 6: 141,546,691 T267A possibly damaging Het
Spc25 A T 2: 69,204,876 M47K probably benign Het
Syne2 A G 12: 76,023,030 E4377G probably damaging Het
Usp34 A G 11: 23,435,998 T2142A probably damaging Het
Zc3h7a A G 16: 11,150,593 probably null Het
Zfp169 T A 13: 48,490,337 K438M possibly damaging Het
Other mutations in Hunk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02312:Hunk APN 16 90475941 missense probably damaging 1.00
IGL02850:Hunk APN 16 90432572 missense probably damaging 1.00
R0067:Hunk UTSW 16 90447312 missense probably damaging 1.00
R0436:Hunk UTSW 16 90464154 missense probably damaging 1.00
R1385:Hunk UTSW 16 90472486 missense possibly damaging 0.61
R1392:Hunk UTSW 16 90472464 missense probably damaging 0.99
R1392:Hunk UTSW 16 90472464 missense probably damaging 0.99
R1487:Hunk UTSW 16 90386637 missense probably damaging 0.99
R1707:Hunk UTSW 16 90386407 start gained probably benign
R1781:Hunk UTSW 16 90432560 missense probably damaging 1.00
R2063:Hunk UTSW 16 90493480 missense probably damaging 0.99
R2066:Hunk UTSW 16 90481245 splice site probably null
R2101:Hunk UTSW 16 90432500 splice site probably null
R2144:Hunk UTSW 16 90432532 missense probably damaging 0.99
R2213:Hunk UTSW 16 90432617 missense probably damaging 1.00
R4646:Hunk UTSW 16 90475903 missense probably damaging 0.99
R4661:Hunk UTSW 16 90447308 critical splice acceptor site probably null
R4834:Hunk UTSW 16 90496198 missense probably benign 0.05
R5094:Hunk UTSW 16 90496666 missense probably benign 0.01
R5766:Hunk UTSW 16 90453739 missense probably damaging 1.00
R5809:Hunk UTSW 16 90475903 missense probably damaging 0.99
R6189:Hunk UTSW 16 90487881 missense probably benign
R6194:Hunk UTSW 16 90496395 missense probably damaging 0.99
R6235:Hunk UTSW 16 90432706 missense probably damaging 1.00
R6468:Hunk UTSW 16 90493432 missense possibly damaging 0.88
R6835:Hunk UTSW 16 90472524 missense probably damaging 1.00
R7127:Hunk UTSW 16 90475891 missense probably damaging 0.99
R7329:Hunk UTSW 16 90386682 missense probably benign 0.37
R7331:Hunk UTSW 16 90472562 missense possibly damaging 0.78
R7473:Hunk UTSW 16 90453700 missense probably damaging 1.00
R7719:Hunk UTSW 16 90496666 missense probably benign 0.01
R7827:Hunk UTSW 16 90481326 missense possibly damaging 0.58
R7894:Hunk UTSW 16 90472465 missense probably damaging 1.00
R7977:Hunk UTSW 16 90472465 missense probably damaging 1.00
Z1176:Hunk UTSW 16 90472573 missense probably damaging 1.00
Z1177:Hunk UTSW 16 90481321 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACAGCTCCTGGACATCTTGG -3'
(R):5'- ACTCTGTACCAAGCACCTCTAG -3'

Sequencing Primer
(F):5'- TCCTGGACATCTTGGAGACAG -3'
(R):5'- GCTCACTAGAGAGACATGTACCTTC -3'
Posted On2015-07-21