Incidental Mutation 'R0047:Kat7'
ID32982
Institutional Source Beutler Lab
Gene Symbol Kat7
Ensembl Gene ENSMUSG00000038909
Gene NameK(lysine) acetyltransferase 7
SynonymsMyst2, Hboa, Hbo1
MMRRC Submission 038341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0047 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location95274259-95310246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95300208 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 119 (N119K)
Ref Sequence ENSEMBL: ENSMUSP00000072416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072621] [ENSMUST00000092766] [ENSMUST00000103159] [ENSMUST00000107733] [ENSMUST00000107734]
Predicted Effect probably benign
Transcript: ENSMUST00000072621
AA Change: N119K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072416
Gene: ENSMUSG00000038909
AA Change: N119K

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 184 214 3.2e-17 PFAM
ZnF_C2H2 338 364 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092766
AA Change: N119K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000090441
Gene: ENSMUSG00000038909
AA Change: N119K

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 186 214 1.2e-16 PFAM
ZnF_C2H2 368 394 1.86e1 SMART
Pfam:MOZ_SAS 395 573 7.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103159
AA Change: N58K

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099448
Gene: ENSMUSG00000038909
AA Change: N58K

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
Pfam:zf-C2HC 123 153 2.8e-17 PFAM
ZnF_C2H2 277 303 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107733
AA Change: N117K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103361
Gene: ENSMUSG00000038909
AA Change: N117K

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.3e-17 PFAM
ZnF_C2H2 336 362 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107734
AA Change: N117K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103362
Gene: ENSMUSG00000038909
AA Change: N117K

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.5e-17 PFAM
ZnF_C2H2 366 392 1.86e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154327
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the multimeric HBO1 complex, which possesses histone H4-specific acetyltransferase activity. This activity is required for functional replication origins and is involved in transcriptional activation of some genes. In both cases, the acetylation of histone H4 helps unfold chromatin so that the DNA can be accessed and replicated or transcribed. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic growth arrest, incomplete embryo turning, disorganized yolk sac vascular plexus, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,264 T405A probably damaging Het
4932438A13Rik T A 3: 36,908,192 L481M possibly damaging Het
Acer1 A T 17: 56,955,624 D175E possibly damaging Het
Acsf2 T C 11: 94,569,342 I395V probably benign Het
Adamts9 G A 6: 92,905,306 probably benign Het
Amigo3 T C 9: 108,054,658 S427P probably benign Het
Ankrd35 A G 3: 96,684,063 K555R probably benign Het
Arhgap35 A T 7: 16,561,992 H1049Q probably benign Het
Arhgef5 G A 6: 43,265,621 probably null Het
Arid4a T G 12: 71,075,419 L858W probably damaging Het
Bbox1 A G 2: 110,268,302 F310S probably damaging Het
Bhlhe22 T C 3: 18,055,569 L261P probably damaging Het
Bmper T A 9: 23,406,686 C534S probably damaging Het
Cacna1d T G 14: 30,346,790 probably benign Het
Camk2g G A 14: 20,771,068 probably benign Het
Capn12 G A 7: 28,890,387 probably null Het
Cdkl4 T G 17: 80,550,845 N115T probably benign Het
Chchd1 T C 14: 20,704,163 S48P possibly damaging Het
Chia1 G T 3: 106,115,257 C49F probably damaging Het
Cnot7 A G 8: 40,495,921 probably benign Het
Crh T C 3: 19,694,037 E147G probably damaging Het
Cux1 T C 5: 136,363,253 probably benign Het
Cyp2b19 T A 7: 26,766,826 D351E probably benign Het
Dctn1 G T 6: 83,182,632 G31* probably null Het
Duox1 T A 2: 122,346,641 probably benign Het
Egflam T G 15: 7,253,430 E382A possibly damaging Het
Ext1 T C 15: 53,345,146 N73S probably benign Het
Ffar4 A G 19: 38,114,004 probably benign Het
Glg1 A T 8: 111,165,582 M866K probably damaging Het
Golm1 T A 13: 59,645,100 H197L probably benign Het
Gtse1 A G 15: 85,862,378 K132E probably damaging Het
Gxylt2 A T 6: 100,733,378 probably benign Het
Hrc T A 7: 45,336,689 S421R probably benign Het
Ighg2c T A 12: 113,288,168 probably benign Het
Ihh A G 1: 74,946,591 I245T probably benign Het
Ilf3 T A 9: 21,388,714 M65K possibly damaging Het
Insr A G 8: 3,202,947 V404A probably damaging Het
Irak2 G T 6: 113,672,953 probably benign Het
Irak2 G A 6: 113,678,738 V367I probably benign Het
Kif9 A G 9: 110,485,038 I33V probably benign Het
Klf17 A G 4: 117,761,032 Y43H probably benign Het
Kng2 T A 16: 22,987,563 T629S possibly damaging Het
Lama1 A T 17: 67,795,186 probably benign Het
Lamb1 T C 12: 31,278,601 I188T possibly damaging Het
Lpp T A 16: 24,661,800 probably benign Het
Lrp12 T C 15: 39,878,239 E360G probably damaging Het
Mark2 A C 19: 7,283,577 probably benign Het
Mmp3 T C 9: 7,451,910 probably benign Het
Mthfd1l T A 10: 3,978,727 probably benign Het
Mtr A T 13: 12,222,226 S569T probably damaging Het
Myh13 T A 11: 67,367,237 S1752T probably benign Het
Myo5a T A 9: 75,156,207 L565H probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nfkb1 A T 3: 135,595,053 L72* probably null Het
Numa1 A G 7: 102,009,453 K296E probably damaging Het
Olfr1477 A G 19: 13,502,589 E82G probably benign Het
Olfr186 T A 16: 59,027,224 M228L probably benign Het
Olfr201 C T 16: 59,269,211 G152D probably damaging Het
Olfr508 A G 7: 108,630,552 I187V probably benign Het
Olfr613 A T 7: 103,552,322 Y179F probably damaging Het
Pcdhb5 A T 18: 37,321,268 I234F possibly damaging Het
Pgm5 T A 19: 24,684,556 I545F probably damaging Het
Pla2g2c T C 4: 138,743,590 probably benign Het
Pnpla7 A T 2: 25,011,606 E548V probably damaging Het
Ppm1m C A 9: 106,196,696 E273* probably null Het
Ppp2r1b C T 9: 50,861,573 R117* probably null Het
Rabgap1l G A 1: 160,231,789 probably benign Het
Rapgef6 T A 11: 54,546,378 M49K possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rnf219 T A 14: 104,503,344 probably null Het
Rtel1 T G 2: 181,323,405 I146M probably damaging Het
Sdr9c7 A T 10: 127,903,672 M219L probably benign Het
Serpina3g T A 12: 104,240,284 S115T possibly damaging Het
Serpinb1a A T 13: 32,850,276 L44Q probably damaging Het
Slc13a4 A G 6: 35,287,362 I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 L177P probably damaging Het
Slc47a2 C T 11: 61,336,242 V167M possibly damaging Het
Snrnp200 C T 2: 127,234,954 probably benign Het
Snx13 C A 12: 35,101,124 probably benign Het
Snx25 C T 8: 46,041,365 A828T probably damaging Het
Spic A G 10: 88,675,941 L151P probably damaging Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Stk32a T C 18: 43,313,378 probably benign Het
Tbx3 A T 5: 119,680,446 E382V probably damaging Het
Tcaf2 A G 6: 42,629,613 I469T probably benign Het
Tln2 A G 9: 67,240,672 probably benign Het
Top2a T A 11: 98,997,856 I1260L probably benign Het
Treml1 C A 17: 48,364,980 S91* probably null Het
Trim26 T C 17: 36,857,864 probably benign Het
Trmt11 T C 10: 30,535,243 N418S probably benign Het
Ttf1 A G 2: 29,084,655 Y801C probably damaging Het
Usp34 C T 11: 23,464,403 A2782V probably benign Het
Vmn2r77 T C 7: 86,811,650 V728A probably benign Het
Vps4a T C 8: 107,036,701 L29P probably damaging Het
Wdfy3 A G 5: 101,944,033 I480T probably damaging Het
Wdr41 A G 13: 95,010,287 I197V probably damaging Het
Ywhag A T 5: 135,911,299 V147E probably damaging Het
Zan A G 5: 137,403,656 M4058T unknown Het
Zfp236 C T 18: 82,680,692 C88Y probably damaging Het
Other mutations in Kat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Kat7 APN 11 95306133 missense probably benign 0.01
IGL03287:Kat7 APN 11 95300109 missense probably damaging 1.00
R0578:Kat7 UTSW 11 95291524 missense probably benign 0.00
R1739:Kat7 UTSW 11 95276547 missense possibly damaging 0.85
R2038:Kat7 UTSW 11 95300102 missense probably benign 0.14
R2115:Kat7 UTSW 11 95303294 missense probably benign 0.10
R2214:Kat7 UTSW 11 95275805 missense probably damaging 0.99
R2355:Kat7 UTSW 11 95291581 missense probably benign
R3425:Kat7 UTSW 11 95303165 missense probably damaging 1.00
R3775:Kat7 UTSW 11 95291531 missense probably benign 0.00
R3811:Kat7 UTSW 11 95291615 splice site probably benign
R4066:Kat7 UTSW 11 95284141 missense possibly damaging 0.93
R4169:Kat7 UTSW 11 95280472 missense probably damaging 0.99
R4657:Kat7 UTSW 11 95277598 missense probably damaging 1.00
R4814:Kat7 UTSW 11 95303123 splice site probably benign
R5186:Kat7 UTSW 11 95286416 missense probably benign 0.00
R6015:Kat7 UTSW 11 95284034 missense probably damaging 1.00
R6820:Kat7 UTSW 11 95284139 missense probably damaging 1.00
R6894:Kat7 UTSW 11 95284084 missense possibly damaging 0.86
R7192:Kat7 UTSW 11 95275830 missense probably benign 0.00
R7217:Kat7 UTSW 11 95291564 missense possibly damaging 0.79
R7728:Kat7 UTSW 11 95300081 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGAGAGATCACTGCCTGAGTCCTTC -3'
(R):5'- AACACTCGTGATGGTGAGAACACAG -3'

Sequencing Primer
(F):5'- CATTTCCGGTTGGAGTTCGA -3'
(R):5'- taggacaggagaggcagg -3'
Posted On2013-05-09