Mutagenetix > Incidental Mutation

Incidental Mutation 'R4445:Cntnap2'

329832

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

Caspr2, 5430425M22Rik

MMRRC Submission

041151-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4445 (G1)

Quality Score

224

Status

Not validated

Chromosome

Chromosomal Location

45036995-47278330 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46736785 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 737 (T737I)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: T737I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: T737I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg6	A	G	10: 14,285,507 (GRCm39)	S1160P	probably damaging	Het
Adgrl1	T	C	8: 84,661,489 (GRCm39)	L962P	probably damaging	Het
Arl6	A	T	16: 59,444,676 (GRCm39)	I51K	probably damaging	Het
Calcoco1	A	G	15: 102,624,175 (GRCm39)		probably null	Het
Cd59a	A	G	2: 103,941,163 (GRCm39)	Q47R	probably benign	Het
Cdkl2	G	A	5: 92,168,168 (GRCm39)	T342I	probably benign	Het
Cfap45	G	A	1: 172,362,794 (GRCm39)	V262M	probably benign	Het
Chd8	A	T	14: 52,441,984 (GRCm39)		probably null	Het
Cplane1	A	G	15: 8,281,672 (GRCm39)	D2837G	unknown	Het
Crot	T	C	5: 9,023,643 (GRCm39)	H415R	probably damaging	Het
Cyp17a1	A	G	19: 46,656,462 (GRCm39)	F411L	probably damaging	Het
Cyp4a12a	G	A	4: 115,183,980 (GRCm39)		probably null	Het
Cysltr2	G	A	14: 73,267,333 (GRCm39)	H126Y	possibly damaging	Het
Ddx56	A	T	11: 6,215,770 (GRCm39)		probably null	Het
Dync2i1	G	A	12: 116,171,335 (GRCm39)	A967V	probably damaging	Het
Elmod1	T	A	9: 53,841,413 (GRCm39)	D93V	probably damaging	Het
Epb41l2	T	C	10: 25,319,701 (GRCm39)	L178P	possibly damaging	Het
Flacc1	A	T	1: 58,706,080 (GRCm39)	I263K	possibly damaging	Het
Galnt10	T	A	11: 57,674,517 (GRCm39)	V502D	probably damaging	Het
Gm11735	T	C	11: 116,629,888 (GRCm39)		noncoding transcript	Het
H4c12	T	C	13: 21,934,513 (GRCm39)	T55A	possibly damaging	Het
Homer3	G	A	8: 70,742,793 (GRCm39)		probably null	Het
Igsf9b	A	G	9: 27,245,548 (GRCm39)	T1172A	probably benign	Het
Ip6k3	A	G	17: 27,364,076 (GRCm39)	I324T	probably benign	Het
Klkb1	C	T	8: 45,730,092 (GRCm39)	S263N	probably benign	Het
Lrit3	A	T	3: 129,582,180 (GRCm39)	C602*	probably null	Het
Lyst	T	C	13: 13,884,149 (GRCm39)	S2986P	probably benign	Het
Mapkapk5	T	C	5: 121,663,291 (GRCm39)	T445A	probably benign	Het
Mms19	A	T	19: 41,952,372 (GRCm39)	M119K	possibly damaging	Het
Myo7a	T	C	7: 97,715,611 (GRCm39)	D63G	probably damaging	Het
Nscme3l	A	T	19: 5,553,022 (GRCm39)	V253D	probably damaging	Het
Nsun2	G	A	13: 69,777,840 (GRCm39)		probably null	Het
Or13a24	C	A	7: 140,154,302 (GRCm39)	P79T	probably damaging	Het
Or1ak2	T	G	2: 36,827,563 (GRCm39)	L144R	probably damaging	Het
Or2ag1b	T	A	7: 106,288,353 (GRCm39)	Y195F	possibly damaging	Het
Or51t4	T	C	7: 102,598,005 (GRCm39)	L101P	possibly damaging	Het
Pabpc2	T	C	18: 39,907,253 (GRCm39)	F173L	probably damaging	Het
Rngtt	A	G	4: 33,499,035 (GRCm39)	I531V	probably benign	Het
Sacs	A	G	14: 61,442,135 (GRCm39)	M1394V	probably benign	Het
Setd1b	G	T	5: 123,286,167 (GRCm39)	E404D	unknown	Het
Slc25a54	G	A	3: 109,005,984 (GRCm39)	R164H	probably benign	Het
Slc2a13	A	G	15: 91,234,223 (GRCm39)	V371A	possibly damaging	Het
Spag9	C	G	11: 93,988,079 (GRCm39)	L798V	possibly damaging	Het
Tbce	A	T	13: 14,172,980 (GRCm39)	S484T	possibly damaging	Het
Tcf12	C	T	9: 71,776,345 (GRCm39)	R399Q	probably damaging	Het
Ttn	A	G	2: 76,615,177 (GRCm39)	V16847A	probably benign	Het
Ttn	A	G	2: 76,687,210 (GRCm39)		probably benign	Het
Vmn1r11	T	G	6: 57,114,515 (GRCm39)	L23V	probably benign	Het
Vmn2r59	C	T	7: 41,691,874 (GRCm39)	C541Y	probably damaging	Het
Vmn2r82	A	C	10: 79,214,874 (GRCm39)	T286P	possibly damaging	Het
Vps13c	T	G	9: 67,889,777 (GRCm39)		probably null	Het
Ypel1	A	T	16: 16,921,464 (GRCm39)	Y73*	probably null	Het
Zdhhc6	T	C	19: 55,291,169 (GRCm39)	I349V	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	45,992,197 (GRCm39)	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46,965,721 (GRCm39)	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47,169,972 (GRCm39)	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46,461,006 (GRCm39)	missense	probably benign
IGL00857:Cntnap2	APN	6	47,026,358 (GRCm39)	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	45,992,399 (GRCm39)	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47,169,947 (GRCm39)	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47,248,305 (GRCm39)	nonsense	probably null
IGL01859:Cntnap2	APN	6	46,965,655 (GRCm39)	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46,211,137 (GRCm39)	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	46,998,588 (GRCm39)	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46,211,254 (GRCm39)	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	46,998,670 (GRCm39)	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46,147,179 (GRCm39)	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46,507,105 (GRCm39)	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46,460,917 (GRCm39)	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45,037,326 (GRCm39)	splice site	probably null
R0352:Cntnap2	UTSW	6	45,969,018 (GRCm39)	splice site	probably null
R0389:Cntnap2	UTSW	6	45,986,571 (GRCm39)	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45,692,750 (GRCm39)	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46,506,839 (GRCm39)	nonsense	probably null
R0611:Cntnap2	UTSW	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46,965,694 (GRCm39)	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47,273,642 (GRCm39)	splice site	probably benign
R0976:Cntnap2	UTSW	6	47,248,164 (GRCm39)	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1387:Cntnap2	UTSW	6	47,084,848 (GRCm39)	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46,507,613 (GRCm39)	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	45,992,264 (GRCm39)	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47,084,826 (GRCm39)	nonsense	probably null
R1757:Cntnap2	UTSW	6	46,736,763 (GRCm39)	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46,965,609 (GRCm39)	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46,507,567 (GRCm39)	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47,275,522 (GRCm39)	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47,275,379 (GRCm39)	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	45,992,200 (GRCm39)	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45,968,837 (GRCm39)	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4030:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4237:Cntnap2	UTSW	6	46,507,324 (GRCm39)	intron	probably benign
R4737:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4918:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4999:Cntnap2	UTSW	6	45,897,768 (GRCm39)	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45,897,860 (GRCm39)	nonsense	probably null
R5748:Cntnap2	UTSW	6	45,692,818 (GRCm39)	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46,506,749 (GRCm39)	intron	probably benign
R6118:Cntnap2	UTSW	6	47,170,011 (GRCm39)	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46,736,742 (GRCm39)	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47,248,232 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45,037,046 (GRCm39)	splice site	probably null
R6385:Cntnap2	UTSW	6	46,833,114 (GRCm39)	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46,736,694 (GRCm39)	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46,147,206 (GRCm39)	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	45,992,191 (GRCm39)	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46,965,580 (GRCm39)	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47,248,205 (GRCm39)	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46,460,963 (GRCm39)	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46,324,079 (GRCm39)	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47,072,627 (GRCm39)	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46,736,707 (GRCm39)	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45,968,975 (GRCm39)	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47,026,156 (GRCm39)	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	45,978,161 (GRCm39)	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46,833,076 (GRCm39)	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46,460,983 (GRCm39)	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46,461,139 (GRCm39)	intron	probably benign
R9209:Cntnap2	UTSW	6	47,026,183 (GRCm39)	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	45,978,112 (GRCm39)	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	45,978,281 (GRCm39)	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	45,978,244 (GRCm39)	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46,211,217 (GRCm39)	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	45,992,165 (GRCm39)	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45,969,009 (GRCm39)	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46,965,726 (GRCm39)	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	45,992,373 (GRCm39)	frame shift	probably null
R9745:Cntnap2	UTSW	6	46,211,100 (GRCm39)	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47,026,261 (GRCm39)	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	46,998,599 (GRCm39)	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	45,986,452 (GRCm39)	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	46,998,688 (GRCm39)	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46,211,179 (GRCm39)	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47,248,082 (GRCm39)	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	45,992,233 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AAAGATGGGCATGCATTTGGTC -3'
(R):5'- TGTCTACTAAATTAGCTCCCCACAC -3'

Sequencing Primer
(F):5'- GGTCTATCAGAAACTGCTATAGCTCC -3'
(R):5'- AAATTAGCTCCCCACACTTCTTAC -3'

Posted On

2015-07-21