Incidental Mutation 'R4445:Igsf9b'
ID329843
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Nameimmunoglobulin superfamily, member 9B
SynonymsLOC235086
MMRRC Submission 041151-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R4445 (G1)
Quality Score213
Status Not validated
Chromosome9
Chromosomal Location27299204-27357546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27334252 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1172 (T1172A)
Ref Sequence ENSEMBL: ENSMUSP00000149356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
Predicted Effect probably benign
Transcript: ENSMUST00000115247
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133213
AA Change: T1168A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: T1168A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214187
Predicted Effect probably benign
Transcript: ENSMUST00000214357
AA Change: T1172A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,502,994 V253D probably damaging Het
2410089E03Rik A G 15: 8,252,188 D2837G unknown Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Adgrl1 T C 8: 83,934,860 L962P probably damaging Het
Als2cr12 A T 1: 58,666,921 I263K possibly damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Calcoco1 A G 15: 102,715,740 probably null Het
Cd59a A G 2: 104,110,818 Q47R probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cfap45 G A 1: 172,535,227 V262M probably benign Het
Chd8 A T 14: 52,204,527 probably null Het
Cntnap2 C T 6: 46,759,851 T737I probably benign Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Cyp4a12a G A 4: 115,326,783 probably null Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Ddx56 A T 11: 6,265,770 probably null Het
Elmod1 T A 9: 53,934,129 D93V probably damaging Het
Epb41l2 T C 10: 25,443,803 L178P possibly damaging Het
Galnt10 T A 11: 57,783,691 V502D probably damaging Het
Gm11735 T C 11: 116,739,062 noncoding transcript Het
Hist1h4k T C 13: 21,750,343 T55A possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ip6k3 A G 17: 27,145,102 I324T probably benign Het
Klkb1 C T 8: 45,277,055 S263N probably benign Het
Lrit3 A T 3: 129,788,531 C602* probably null Het
Lyst T C 13: 13,709,564 S2986P probably benign Het
Mapkapk5 T C 5: 121,525,228 T445A probably benign Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo7a T C 7: 98,066,404 D63G probably damaging Het
Nsun2 G A 13: 69,629,721 probably null Het
Olfr356 T G 2: 36,937,551 L144R probably damaging Het
Olfr538 C A 7: 140,574,389 P79T probably damaging Het
Olfr574 T C 7: 102,948,798 L101P possibly damaging Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Pabpc2 T C 18: 39,774,200 F173L probably damaging Het
Ppil2 A T 16: 17,103,600 Y73* probably null Het
Rngtt A G 4: 33,499,035 I531V probably benign Het
Sacs A G 14: 61,204,686 M1394V probably benign Het
Setd1b G T 5: 123,148,104 E404D unknown Het
Slc25a54 G A 3: 109,098,668 R164H probably benign Het
Slc2a13 A G 15: 91,350,020 V371A possibly damaging Het
Spag9 C G 11: 94,097,253 L798V possibly damaging Het
Tbce A T 13: 13,998,395 S484T possibly damaging Het
Tcf12 C T 9: 71,869,063 R399Q probably damaging Het
Ttn A G 2: 76,784,833 V16847A probably benign Het
Ttn A G 2: 76,856,866 probably benign Het
Vmn1r11 T G 6: 57,137,530 L23V probably benign Het
Vmn2r59 C T 7: 42,042,450 C541Y probably damaging Het
Vmn2r82 A C 10: 79,379,040 T286P possibly damaging Het
Vps13c T G 9: 67,982,495 probably null Het
Wdr60 G A 12: 116,207,715 A967V probably damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27319655 missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27334304 missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27328606 missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27333130 missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27333082 missense probably damaging 0.98
IGL03014:Igsf9b UTSW 9 27322636 missense probably benign 0.00
R0127:Igsf9b UTSW 9 27334385 missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27334582 missense probably benign 0.01
R0520:Igsf9b UTSW 9 27323250 missense probably benign 0.00
R0534:Igsf9b UTSW 9 27333062 splice site probably null
R0613:Igsf9b UTSW 9 27326920 missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27323361 critical splice donor site probably null
R0828:Igsf9b UTSW 9 27319605 nonsense probably null
R0879:Igsf9b UTSW 9 27333742 missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27319316 missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27332553 splice site probably null
R1162:Igsf9b UTSW 9 27326889 missense probably benign
R1758:Igsf9b UTSW 9 27334252 missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27317827 missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27311593 missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27331732 missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27322239 missense possibly damaging 0.82
R2150:Igsf9b UTSW 9 27334337 missense probably damaging 1.00
R2228:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R3415:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3417:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27334577 missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4379:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27322917 missense probably damaging 1.00
R4446:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4787:Igsf9b UTSW 9 27317456 missense probably benign 0.26
R4887:Igsf9b UTSW 9 27322650 missense probably benign 0.45
R5085:Igsf9b UTSW 9 27317437 missense probably benign 0.03
R5360:Igsf9b UTSW 9 27311672 missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27334276 small insertion probably benign
R5686:Igsf9b UTSW 9 27324179 missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27328530 missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27323235 missense probably benign 0.44
R6304:Igsf9b UTSW 9 27342575 missense probably benign 0.19
R6359:Igsf9b UTSW 9 27309599 missense probably benign 0.25
R6367:Igsf9b UTSW 9 27309525 nonsense probably null
R6556:Igsf9b UTSW 9 27329555 missense probably damaging 1.00
R7058:Igsf9b UTSW 9 27322854 missense probably damaging 0.99
R7165:Igsf9b UTSW 9 27334240 missense probably benign
R7180:Igsf9b UTSW 9 27322668 missense possibly damaging 0.95
R7212:Igsf9b UTSW 9 27331696 missense probably damaging 0.98
R7461:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R7605:Igsf9b UTSW 9 27323312 missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27345890 missense probably benign
R7613:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R8072:Igsf9b UTSW 9 27317364 missense possibly damaging 0.94
R8163:Igsf9b UTSW 9 27322611 splice site probably null
X0013:Igsf9b UTSW 9 27331725 missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27309461 missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27334372 missense probably damaging 1.00
Z1176:Igsf9b UTSW 9 27317353 critical splice acceptor site probably null
Z1177:Igsf9b UTSW 9 27334292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTATCTCTGGAGGCACC -3'
(R):5'- AGGGTGATCTCTGACATCTCTGC -3'

Sequencing Primer
(F):5'- TAGGCAAGTCACCTGGCAG -3'
(R):5'- GATCTCTGACATCTCTGCCTGCTG -3'
Posted On2015-07-21