Incidental Mutation 'R4445:Wdr60'
ID329854
Institutional Source Beutler Lab
Gene Symbol Wdr60
Ensembl Gene ENSMUSG00000042050
Gene NameWD repeat domain 60
SynonymsD430033N04Rik
MMRRC Submission 041151-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4445 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116206262-116263022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116207715 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 967 (A967V)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349]
Predicted Effect probably damaging
Transcript: ENSMUST00000039349
AA Change: A967V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: A967V

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222764
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,502,994 V253D probably damaging Het
2410089E03Rik A G 15: 8,252,188 D2837G unknown Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Adgrl1 T C 8: 83,934,860 L962P probably damaging Het
Als2cr12 A T 1: 58,666,921 I263K possibly damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Calcoco1 A G 15: 102,715,740 probably null Het
Cd59a A G 2: 104,110,818 Q47R probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cfap45 G A 1: 172,535,227 V262M probably benign Het
Chd8 A T 14: 52,204,527 probably null Het
Cntnap2 C T 6: 46,759,851 T737I probably benign Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Cyp4a12a G A 4: 115,326,783 probably null Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Ddx56 A T 11: 6,265,770 probably null Het
Elmod1 T A 9: 53,934,129 D93V probably damaging Het
Epb41l2 T C 10: 25,443,803 L178P possibly damaging Het
Galnt10 T A 11: 57,783,691 V502D probably damaging Het
Gm11735 T C 11: 116,739,062 noncoding transcript Het
Hist1h4k T C 13: 21,750,343 T55A possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Ip6k3 A G 17: 27,145,102 I324T probably benign Het
Klkb1 C T 8: 45,277,055 S263N probably benign Het
Lrit3 A T 3: 129,788,531 C602* probably null Het
Lyst T C 13: 13,709,564 S2986P probably benign Het
Mapkapk5 T C 5: 121,525,228 T445A probably benign Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo7a T C 7: 98,066,404 D63G probably damaging Het
Nsun2 G A 13: 69,629,721 probably null Het
Olfr356 T G 2: 36,937,551 L144R probably damaging Het
Olfr538 C A 7: 140,574,389 P79T probably damaging Het
Olfr574 T C 7: 102,948,798 L101P possibly damaging Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Pabpc2 T C 18: 39,774,200 F173L probably damaging Het
Ppil2 A T 16: 17,103,600 Y73* probably null Het
Rngtt A G 4: 33,499,035 I531V probably benign Het
Sacs A G 14: 61,204,686 M1394V probably benign Het
Setd1b G T 5: 123,148,104 E404D unknown Het
Slc25a54 G A 3: 109,098,668 R164H probably benign Het
Slc2a13 A G 15: 91,350,020 V371A possibly damaging Het
Spag9 C G 11: 94,097,253 L798V possibly damaging Het
Tbce A T 13: 13,998,395 S484T possibly damaging Het
Tcf12 C T 9: 71,869,063 R399Q probably damaging Het
Ttn A G 2: 76,784,833 V16847A probably benign Het
Ttn A G 2: 76,856,866 probably benign Het
Vmn1r11 T G 6: 57,137,530 L23V probably benign Het
Vmn2r59 C T 7: 42,042,450 C541Y probably damaging Het
Vmn2r82 A C 10: 79,379,040 T286P possibly damaging Het
Vps13c T G 9: 67,982,495 probably null Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Wdr60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Wdr60 APN 12 116241780 missense probably benign 0.01
IGL00668:Wdr60 APN 12 116257428 missense probably benign 0.32
IGL00914:Wdr60 APN 12 116232603 missense probably damaging 1.00
IGL01061:Wdr60 APN 12 116229704 missense probably benign 0.45
IGL01375:Wdr60 APN 12 116229676 missense possibly damaging 0.91
IGL01758:Wdr60 APN 12 116218798 missense possibly damaging 0.82
IGL01930:Wdr60 APN 12 116225963 critical splice donor site probably null
IGL02028:Wdr60 APN 12 116256061 missense probably benign 0.06
IGL03180:Wdr60 APN 12 116218865 missense probably benign 0.07
F5770:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
R0153:Wdr60 UTSW 12 116232636 missense probably benign 0.01
R0265:Wdr60 UTSW 12 116257406 splice site probably benign
R0364:Wdr60 UTSW 12 116257477 splice site probably benign
R0601:Wdr60 UTSW 12 116255935 missense possibly damaging 0.79
R0624:Wdr60 UTSW 12 116248290 missense probably damaging 0.98
R0755:Wdr60 UTSW 12 116211792 missense probably benign 0.01
R1023:Wdr60 UTSW 12 116232657 missense probably damaging 1.00
R1065:Wdr60 UTSW 12 116256076 missense probably damaging 0.98
R1543:Wdr60 UTSW 12 116231784 splice site probably benign
R1663:Wdr60 UTSW 12 116229610 missense probably benign 0.01
R1678:Wdr60 UTSW 12 116225970 missense probably damaging 1.00
R1719:Wdr60 UTSW 12 116255912 missense probably benign
R1755:Wdr60 UTSW 12 116226029 missense probably damaging 0.98
R1832:Wdr60 UTSW 12 116207743 missense probably damaging 0.99
R1918:Wdr60 UTSW 12 116232601 missense probably damaging 0.96
R2291:Wdr60 UTSW 12 116229571 splice site probably null
R2444:Wdr60 UTSW 12 116232669 missense possibly damaging 0.93
R3419:Wdr60 UTSW 12 116224977 missense probably benign 0.05
R3699:Wdr60 UTSW 12 116211842 nonsense probably null
R3700:Wdr60 UTSW 12 116211842 nonsense probably null
R4664:Wdr60 UTSW 12 116256211 missense probably damaging 0.99
R4954:Wdr60 UTSW 12 116256025 missense probably damaging 1.00
R5057:Wdr60 UTSW 12 116213413 missense probably benign 0.43
R5163:Wdr60 UTSW 12 116255866 missense possibly damaging 0.76
R5341:Wdr60 UTSW 12 116255914 missense possibly damaging 0.51
R5560:Wdr60 UTSW 12 116218113 missense probably damaging 0.98
R5870:Wdr60 UTSW 12 116256245 missense possibly damaging 0.94
R5925:Wdr60 UTSW 12 116233394 missense possibly damaging 0.82
R6223:Wdr60 UTSW 12 116257458 missense possibly damaging 0.95
R6364:Wdr60 UTSW 12 116241732 missense probably damaging 1.00
R6450:Wdr60 UTSW 12 116246727 nonsense probably null
R6462:Wdr60 UTSW 12 116229631 missense probably benign
R6751:Wdr60 UTSW 12 116213456 missense possibly damaging 0.52
R6896:Wdr60 UTSW 12 116229671 missense possibly damaging 0.52
R6962:Wdr60 UTSW 12 116211778 missense probably damaging 1.00
R7033:Wdr60 UTSW 12 116211891 missense probably benign 0.03
R7042:Wdr60 UTSW 12 116254441 missense probably benign 0.02
R7254:Wdr60 UTSW 12 116262585 intron probably benign
R7567:Wdr60 UTSW 12 116254510 splice site probably null
R7889:Wdr60 UTSW 12 116255939 nonsense probably null
R8082:Wdr60 UTSW 12 116213507 critical splice acceptor site probably null
R8288:Wdr60 UTSW 12 116213725 missense probably damaging 1.00
R8309:Wdr60 UTSW 12 116256085 missense probably damaging 1.00
V7581:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7582:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7583:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
X0063:Wdr60 UTSW 12 116255869 missense probably benign
Z1177:Wdr60 UTSW 12 116246099 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGAACACAGAGTTAAGGGATCC -3'
(R):5'- TTTCATGGATCTGCCCAGACC -3'

Sequencing Primer
(F):5'- GGGATCCATCTGTAATCAAGTCTC -3'
(R):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
Posted On2015-07-21