Mutagenetix > Incidental Mutations

Incidental Mutation 'R4445:Ppil2'

329866

Institutional Source

Beutler Lab

Gene Symbol

Ppil2

Ensembl Gene

ENSMUSG00000022771

Gene Name

peptidylprolyl isomerase (cyclophilin)-like 2

Synonyms

MMRRC Submission

041151-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4445 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17086555-17111257 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 17103600 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 73 (Y73*)

Ref Sequence

ENSEMBL: ENSMUSP00000155861 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000115719] [ENSMUST00000115721] [ENSMUST00000164458] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231712] [ENSMUST00000232481]

Predicted Effect

probably null
Transcript: ENSMUST00000023455
AA Change: Y73*

SMART Domains

Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: Y73*

Domain	Start	End	E-Value	Type
Ubox	42	101	2.53e-14	SMART
Pfam:Pro_isomerase	281	433	1.3e-50	PFAM
low complexity region	493	507	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115719
AA Change: Y73*

SMART Domains

Protein: ENSMUSP00000111384
Gene: ENSMUSG00000022771
AA Change: Y73*

Domain	Start	End	E-Value	Type
Ubox	42	101	2.53e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000115721
AA Change: Y73*

SMART Domains

Protein: ENSMUSP00000111386
Gene: ENSMUSG00000022771
AA Change: Y73*

Domain	Start	End	E-Value	Type
Ubox	42	101	2.53e-14	SMART
Pfam:Pro_isomerase	281	433	3.7e-53	PFAM
low complexity region	493	507	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134849

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153927

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156521

Predicted Effect

probably null
Transcript: ENSMUST00000164458
AA Change: Y73*

SMART Domains

Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: Y73*

Domain	Start	End	E-Value	Type
Ubox	42	101	2.53e-14	SMART
Pfam:Pro_isomerase	281	433	1.3e-50	PFAM
low complexity region	493	507	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000231245
AA Change: Y73*

Predicted Effect

probably null
Transcript: ENSMUST00000231451
AA Change: Y73*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231587

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231635

Predicted Effect

probably null
Transcript: ENSMUST00000231712
AA Change: Y73*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232169

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232510

Predicted Effect

probably benign
Transcript: ENSMUST00000232481

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	A	T	19: 5,502,994	V253D	probably damaging	Het
2410089E03Rik	A	G	15: 8,252,188	D2837G	unknown	Het
Adgrg6	A	G	10: 14,409,763	S1160P	probably damaging	Het
Adgrl1	T	C	8: 83,934,860	L962P	probably damaging	Het
Als2cr12	A	T	1: 58,666,921	I263K	possibly damaging	Het
Arl6	A	T	16: 59,624,313	I51K	probably damaging	Het
Calcoco1	A	G	15: 102,715,740		probably null	Het
Cd59a	A	G	2: 104,110,818	Q47R	probably benign	Het
Cdkl2	G	A	5: 92,020,309	T342I	probably benign	Het
Cfap45	G	A	1: 172,535,227	V262M	probably benign	Het
Chd8	A	T	14: 52,204,527		probably null	Het
Cntnap2	C	T	6: 46,759,851	T737I	probably benign	Het
Crot	T	C	5: 8,973,643	H415R	probably damaging	Het
Cyp17a1	A	G	19: 46,668,023	F411L	probably damaging	Het
Cyp4a12a	G	A	4: 115,326,783		probably null	Het
Cysltr2	G	A	14: 73,029,893	H126Y	possibly damaging	Het
Ddx56	A	T	11: 6,265,770		probably null	Het
Elmod1	T	A	9: 53,934,129	D93V	probably damaging	Het
Epb41l2	T	C	10: 25,443,803	L178P	possibly damaging	Het
Galnt10	T	A	11: 57,783,691	V502D	probably damaging	Het
Gm11735	T	C	11: 116,739,062		noncoding transcript	Het
Hist1h4k	T	C	13: 21,750,343	T55A	possibly damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Igsf9b	A	G	9: 27,334,252	T1172A	probably benign	Het
Ip6k3	A	G	17: 27,145,102	I324T	probably benign	Het
Klkb1	C	T	8: 45,277,055	S263N	probably benign	Het
Lrit3	A	T	3: 129,788,531	C602*	probably null	Het
Lyst	T	C	13: 13,709,564	S2986P	probably benign	Het
Mapkapk5	T	C	5: 121,525,228	T445A	probably benign	Het
Mms19	A	T	19: 41,963,933	M119K	possibly damaging	Het
Myo7a	T	C	7: 98,066,404	D63G	probably damaging	Het
Nsun2	G	A	13: 69,629,721		probably null	Het
Olfr356	T	G	2: 36,937,551	L144R	probably damaging	Het
Olfr538	C	A	7: 140,574,389	P79T	probably damaging	Het
Olfr574	T	C	7: 102,948,798	L101P	possibly damaging	Het
Olfr694	T	A	7: 106,689,146	Y195F	possibly damaging	Het
Pabpc2	T	C	18: 39,774,200	F173L	probably damaging	Het
Rngtt	A	G	4: 33,499,035	I531V	probably benign	Het
Sacs	A	G	14: 61,204,686	M1394V	probably benign	Het
Setd1b	G	T	5: 123,148,104	E404D	unknown	Het
Slc25a54	G	A	3: 109,098,668	R164H	probably benign	Het
Slc2a13	A	G	15: 91,350,020	V371A	possibly damaging	Het
Spag9	C	G	11: 94,097,253	L798V	possibly damaging	Het
Tbce	A	T	13: 13,998,395	S484T	possibly damaging	Het
Tcf12	C	T	9: 71,869,063	R399Q	probably damaging	Het
Ttn	A	G	2: 76,784,833	V16847A	probably benign	Het
Ttn	A	G	2: 76,856,866		probably benign	Het
Vmn1r11	T	G	6: 57,137,530	L23V	probably benign	Het
Vmn2r59	C	T	7: 42,042,450	C541Y	probably damaging	Het
Vmn2r82	A	C	10: 79,379,040	T286P	possibly damaging	Het
Vps13c	T	G	9: 67,982,495		probably null	Het
Wdr60	G	A	12: 116,207,715	A967V	probably damaging	Het
Zdhhc6	T	C	19: 55,302,737	I349V	probably benign	Het

Other mutations in Ppil2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ppil2	APN	16	17091212	missense	probably damaging	1.00
IGL02392:Ppil2	APN	16	17088838	missense	probably benign
IGL02559:Ppil2	APN	16	17109651	missense	possibly damaging	0.80
IGL02708:Ppil2	APN	16	17106008	missense	probably benign	0.03
IGL02724:Ppil2	APN	16	17103602	missense	probably benign	0.08
zagnut	UTSW	16	17096041	missense	possibly damaging	0.62
R0592:Ppil2	UTSW	16	17107219	missense	probably benign
R0975:Ppil2	UTSW	16	17107213	missense	probably benign	0.00
R1258:Ppil2	UTSW	16	17106053	missense	probably damaging	1.00
R1677:Ppil2	UTSW	16	17103610	missense	probably damaging	1.00
R1728:Ppil2	UTSW	16	17089419	unclassified	probably benign
R1739:Ppil2	UTSW	16	17089419	unclassified	probably benign
R1784:Ppil2	UTSW	16	17089419	unclassified	probably benign
R1853:Ppil2	UTSW	16	17107223	missense	probably benign	0.00
R3608:Ppil2	UTSW	16	17092290	nonsense	probably null
R3769:Ppil2	UTSW	16	17109668	missense	probably benign	0.30
R4518:Ppil2	UTSW	16	17096041	missense	possibly damaging	0.62
R5066:Ppil2	UTSW	16	17109675	missense	probably benign	0.03
R5842:Ppil2	UTSW	16	17094987	missense	possibly damaging	0.66
R6013:Ppil2	UTSW	16	17100265	missense	probably damaging	1.00
R6415:Ppil2	UTSW	16	17103574	critical splice donor site	probably null
R7735:Ppil2	UTSW	16	17100260	missense	probably benign	0.11
RF014:Ppil2	UTSW	16	17097418	missense	probably damaging	1.00
X0010:Ppil2	UTSW	16	17095037	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- TGTAGAAAGCACAGGACTGTC -3'
(R):5'- CGCTCATTCTGGCCCAAAG -3'

Sequencing Primer
(F):5'- GTCACTCCCAGGTTCTGTGAG -3'
(R):5'- CTGGGATTTGAACTCAGGACC -3'

Posted On

2015-07-21