Incidental Mutation 'R4445:Ip6k3'
ID329869
Institutional Source Beutler Lab
Gene Symbol Ip6k3
Ensembl Gene ENSMUSG00000024210
Gene Nameinositol hexaphosphate kinase 3
SynonymsD830007E07Rik, Ihpk3
MMRRC Submission 041151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4445 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27143969-27167764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27145102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 324 (I324T)
Ref Sequence ENSEMBL: ENSMUSP00000025046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025046]
Predicted Effect probably benign
Transcript: ENSMUST00000025046
AA Change: I324T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025046
Gene: ENSMUSG00000024210
AA Change: I324T

DomainStartEndE-ValueType
Pfam:IPK 193 390 3e-68 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cerebellar Purkinje cell morphology, reduced synapse number, and defects in motor learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,502,994 V253D probably damaging Het
2410089E03Rik A G 15: 8,252,188 D2837G unknown Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Adgrl1 T C 8: 83,934,860 L962P probably damaging Het
Als2cr12 A T 1: 58,666,921 I263K possibly damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Calcoco1 A G 15: 102,715,740 probably null Het
Cd59a A G 2: 104,110,818 Q47R probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cfap45 G A 1: 172,535,227 V262M probably benign Het
Chd8 A T 14: 52,204,527 probably null Het
Cntnap2 C T 6: 46,759,851 T737I probably benign Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Cyp4a12a G A 4: 115,326,783 probably null Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Ddx56 A T 11: 6,265,770 probably null Het
Elmod1 T A 9: 53,934,129 D93V probably damaging Het
Epb41l2 T C 10: 25,443,803 L178P possibly damaging Het
Galnt10 T A 11: 57,783,691 V502D probably damaging Het
Gm11735 T C 11: 116,739,062 noncoding transcript Het
Hist1h4k T C 13: 21,750,343 T55A possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klkb1 C T 8: 45,277,055 S263N probably benign Het
Lrit3 A T 3: 129,788,531 C602* probably null Het
Lyst T C 13: 13,709,564 S2986P probably benign Het
Mapkapk5 T C 5: 121,525,228 T445A probably benign Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo7a T C 7: 98,066,404 D63G probably damaging Het
Nsun2 G A 13: 69,629,721 probably null Het
Olfr356 T G 2: 36,937,551 L144R probably damaging Het
Olfr538 C A 7: 140,574,389 P79T probably damaging Het
Olfr574 T C 7: 102,948,798 L101P possibly damaging Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Pabpc2 T C 18: 39,774,200 F173L probably damaging Het
Ppil2 A T 16: 17,103,600 Y73* probably null Het
Rngtt A G 4: 33,499,035 I531V probably benign Het
Sacs A G 14: 61,204,686 M1394V probably benign Het
Setd1b G T 5: 123,148,104 E404D unknown Het
Slc25a54 G A 3: 109,098,668 R164H probably benign Het
Slc2a13 A G 15: 91,350,020 V371A possibly damaging Het
Spag9 C G 11: 94,097,253 L798V possibly damaging Het
Tbce A T 13: 13,998,395 S484T possibly damaging Het
Tcf12 C T 9: 71,869,063 R399Q probably damaging Het
Ttn A G 2: 76,784,833 V16847A probably benign Het
Ttn A G 2: 76,856,866 probably benign Het
Vmn1r11 T G 6: 57,137,530 L23V probably benign Het
Vmn2r59 C T 7: 42,042,450 C541Y probably damaging Het
Vmn2r82 A C 10: 79,379,040 T286P possibly damaging Het
Vps13c T G 9: 67,982,495 probably null Het
Wdr60 G A 12: 116,207,715 A967V probably damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Ip6k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Ip6k3 APN 17 27151060 missense probably benign
R0200:Ip6k3 UTSW 17 27145025 missense probably damaging 1.00
R0220:Ip6k3 UTSW 17 27145229 missense probably damaging 1.00
R1448:Ip6k3 UTSW 17 27145268 missense possibly damaging 0.90
R1749:Ip6k3 UTSW 17 27145079 missense probably benign 0.00
R1956:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R1957:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R3125:Ip6k3 UTSW 17 27157542 missense probably damaging 1.00
R3798:Ip6k3 UTSW 17 27145106 missense probably benign 0.01
R3806:Ip6k3 UTSW 17 27145000 missense probably damaging 1.00
R4506:Ip6k3 UTSW 17 27145180 missense possibly damaging 0.69
R4651:Ip6k3 UTSW 17 27145291 missense probably damaging 1.00
R5972:Ip6k3 UTSW 17 27149960 missense possibly damaging 0.48
R6119:Ip6k3 UTSW 17 27148625 missense possibly damaging 0.72
R7140:Ip6k3 UTSW 17 27144995 missense probably damaging 1.00
R7340:Ip6k3 UTSW 17 27148530 missense probably benign 0.00
R7811:Ip6k3 UTSW 17 27157583 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAATGAGGTTTTCCAGGCC -3'
(R):5'- TCAAACTGATCAGAAGAGCTTTCTC -3'

Sequencing Primer
(F):5'- GGTTTTCCAGGCCAAAAATATAGCC -3'
(R):5'- TAAGTACTATGGAAGGAAGCTCTC -3'
Posted On2015-07-21