Mutagenetix > Incidental Mutation

Incidental Mutation 'R4445:Cyp17a1'

329873

Institutional Source

Beutler Lab

Gene Symbol

Cyp17a1

Ensembl Gene

ENSMUSG00000003555

Gene Name

cytochrome P450, family 17, subfamily a, polypeptide 1

Synonyms

steroid 17-alpha hydroxylase, p450c17, Cyp17

MMRRC Submission

041151-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R4445 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46667165-46672974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46668023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 411 (F411L)

Ref Sequence

ENSEMBL: ENSMUSP00000026012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026012]

AlphaFold

P27786

Predicted Effect

probably damaging
Transcript: ENSMUST00000026012
AA Change: F411L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: F411L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:p450	28	492	2.6e-140	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131142

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156577

Meta Mutation Damage Score

0.9476

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	A	T	19: 5,502,994	V253D	probably damaging	Het
2410089E03Rik	A	G	15: 8,252,188	D2837G	unknown	Het
Adgrg6	A	G	10: 14,409,763	S1160P	probably damaging	Het
Adgrl1	T	C	8: 83,934,860	L962P	probably damaging	Het
Als2cr12	A	T	1: 58,666,921	I263K	possibly damaging	Het
Arl6	A	T	16: 59,624,313	I51K	probably damaging	Het
Calcoco1	A	G	15: 102,715,740		probably null	Het
Cd59a	A	G	2: 104,110,818	Q47R	probably benign	Het
Cdkl2	G	A	5: 92,020,309	T342I	probably benign	Het
Cfap45	G	A	1: 172,535,227	V262M	probably benign	Het
Chd8	A	T	14: 52,204,527		probably null	Het
Cntnap2	C	T	6: 46,759,851	T737I	probably benign	Het
Crot	T	C	5: 8,973,643	H415R	probably damaging	Het
Cyp4a12a	G	A	4: 115,326,783		probably null	Het
Cysltr2	G	A	14: 73,029,893	H126Y	possibly damaging	Het
Ddx56	A	T	11: 6,265,770		probably null	Het
Elmod1	T	A	9: 53,934,129	D93V	probably damaging	Het
Epb41l2	T	C	10: 25,443,803	L178P	possibly damaging	Het
Galnt10	T	A	11: 57,783,691	V502D	probably damaging	Het
Gm11735	T	C	11: 116,739,062		noncoding transcript	Het
Hist1h4k	T	C	13: 21,750,343	T55A	possibly damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Igsf9b	A	G	9: 27,334,252	T1172A	probably benign	Het
Ip6k3	A	G	17: 27,145,102	I324T	probably benign	Het
Klkb1	C	T	8: 45,277,055	S263N	probably benign	Het
Lrit3	A	T	3: 129,788,531	C602*	probably null	Het
Lyst	T	C	13: 13,709,564	S2986P	probably benign	Het
Mapkapk5	T	C	5: 121,525,228	T445A	probably benign	Het
Mms19	A	T	19: 41,963,933	M119K	possibly damaging	Het
Myo7a	T	C	7: 98,066,404	D63G	probably damaging	Het
Nsun2	G	A	13: 69,629,721		probably null	Het
Olfr356	T	G	2: 36,937,551	L144R	probably damaging	Het
Olfr538	C	A	7: 140,574,389	P79T	probably damaging	Het
Olfr574	T	C	7: 102,948,798	L101P	possibly damaging	Het
Olfr694	T	A	7: 106,689,146	Y195F	possibly damaging	Het
Pabpc2	T	C	18: 39,774,200	F173L	probably damaging	Het
Ppil2	A	T	16: 17,103,600	Y73*	probably null	Het
Rngtt	A	G	4: 33,499,035	I531V	probably benign	Het
Sacs	A	G	14: 61,204,686	M1394V	probably benign	Het
Setd1b	G	T	5: 123,148,104	E404D	unknown	Het
Slc25a54	G	A	3: 109,098,668	R164H	probably benign	Het
Slc2a13	A	G	15: 91,350,020	V371A	possibly damaging	Het
Spag9	C	G	11: 94,097,253	L798V	possibly damaging	Het
Tbce	A	T	13: 13,998,395	S484T	possibly damaging	Het
Tcf12	C	T	9: 71,869,063	R399Q	probably damaging	Het
Ttn	A	G	2: 76,784,833	V16847A	probably benign	Het
Ttn	A	G	2: 76,856,866		probably benign	Het
Vmn1r11	T	G	6: 57,137,530	L23V	probably benign	Het
Vmn2r59	C	T	7: 42,042,450	C541Y	probably damaging	Het
Vmn2r82	A	C	10: 79,379,040	T286P	possibly damaging	Het
Vps13c	T	G	9: 67,982,495		probably null	Het
Wdr60	G	A	12: 116,207,715	A967V	probably damaging	Het
Zdhhc6	T	C	19: 55,302,737	I349V	probably benign	Het

Other mutations in Cyp17a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01524:Cyp17a1	APN	19	46671056	missense	probably benign	0.00
IGL01839:Cyp17a1	APN	19	46670671	missense	possibly damaging	0.89
IGL01901:Cyp17a1	APN	19	46671092	missense	possibly damaging	0.64
IGL02033:Cyp17a1	APN	19	46672607	nonsense	probably null
IGL02349:Cyp17a1	APN	19	46667497	missense	probably damaging	1.00
IGL02663:Cyp17a1	APN	19	46672566	missense	probably damaging	1.00
IGL02883:Cyp17a1	APN	19	46669351	missense	probably benign	0.00
IGL03092:Cyp17a1	APN	19	46672611	missense	possibly damaging	0.79
IGL03239:Cyp17a1	APN	19	46667357	missense	probably damaging	1.00
IGL03336:Cyp17a1	APN	19	46671035	missense	probably benign	0.00
R3773:Cyp17a1	UTSW	19	46669723	missense	probably damaging	0.97
R4446:Cyp17a1	UTSW	19	46668023	missense	probably damaging	1.00
R4572:Cyp17a1	UTSW	19	46670551	missense	probably damaging	1.00
R5544:Cyp17a1	UTSW	19	46672654	missense	probably damaging	1.00
R5730:Cyp17a1	UTSW	19	46672656	missense	possibly damaging	0.49
R6163:Cyp17a1	UTSW	19	46669322	missense	possibly damaging	0.69
R6271:Cyp17a1	UTSW	19	46672720	missense	probably benign	0.17
R6728:Cyp17a1	UTSW	19	46669234	missense	probably benign
R6729:Cyp17a1	UTSW	19	46670581	missense	probably benign
R7025:Cyp17a1	UTSW	19	46670980	missense	probably damaging	0.98
R7395:Cyp17a1	UTSW	19	46670695	missense	probably benign
R8056:Cyp17a1	UTSW	19	46670591	missense	possibly damaging	0.95
R8308:Cyp17a1	UTSW	19	46668077	missense	probably benign	0.09
R8735:Cyp17a1	UTSW	19	46671094	critical splice acceptor site	probably null
R8737:Cyp17a1	UTSW	19	46669727	missense	probably benign	0.09
R9091:Cyp17a1	UTSW	19	46667591	missense	probably benign	0.00
R9270:Cyp17a1	UTSW	19	46667591	missense	probably benign	0.00
R9364:Cyp17a1	UTSW	19	46668726	missense	probably damaging	1.00
R9554:Cyp17a1	UTSW	19	46668726	missense	probably damaging	1.00
X0020:Cyp17a1	UTSW	19	46671020	missense	possibly damaging	0.88
Z1177:Cyp17a1	UTSW	19	46672659	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCTGGGGCAATCTCCAGTAG -3'
(R):5'- TCTAGATGTAATCCTGGCAGAAACC -3'

Sequencing Primer
(F):5'- CAATCTCCAGTAGGATGGGAAC -3'
(R):5'- ATGATTGAGAATGGGGGAGGGTTC -3'

Posted On

2015-07-21