Incidental Mutation 'R4445:Cyp17a1'
ID 329873
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission 041151-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R4445 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46656462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 411 (F411L)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: F411L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: F411L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,285,507 (GRCm39) S1160P probably damaging Het
Adgrl1 T C 8: 84,661,489 (GRCm39) L962P probably damaging Het
Arl6 A T 16: 59,444,676 (GRCm39) I51K probably damaging Het
Calcoco1 A G 15: 102,624,175 (GRCm39) probably null Het
Cd59a A G 2: 103,941,163 (GRCm39) Q47R probably benign Het
Cdkl2 G A 5: 92,168,168 (GRCm39) T342I probably benign Het
Cfap45 G A 1: 172,362,794 (GRCm39) V262M probably benign Het
Chd8 A T 14: 52,441,984 (GRCm39) probably null Het
Cntnap2 C T 6: 46,736,785 (GRCm39) T737I probably benign Het
Cplane1 A G 15: 8,281,672 (GRCm39) D2837G unknown Het
Crot T C 5: 9,023,643 (GRCm39) H415R probably damaging Het
Cyp4a12a G A 4: 115,183,980 (GRCm39) probably null Het
Cysltr2 G A 14: 73,267,333 (GRCm39) H126Y possibly damaging Het
Ddx56 A T 11: 6,215,770 (GRCm39) probably null Het
Dync2i1 G A 12: 116,171,335 (GRCm39) A967V probably damaging Het
Elmod1 T A 9: 53,841,413 (GRCm39) D93V probably damaging Het
Epb41l2 T C 10: 25,319,701 (GRCm39) L178P possibly damaging Het
Flacc1 A T 1: 58,706,080 (GRCm39) I263K possibly damaging Het
Galnt10 T A 11: 57,674,517 (GRCm39) V502D probably damaging Het
Gm11735 T C 11: 116,629,888 (GRCm39) noncoding transcript Het
H4c12 T C 13: 21,934,513 (GRCm39) T55A possibly damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Igsf9b A G 9: 27,245,548 (GRCm39) T1172A probably benign Het
Ip6k3 A G 17: 27,364,076 (GRCm39) I324T probably benign Het
Klkb1 C T 8: 45,730,092 (GRCm39) S263N probably benign Het
Lrit3 A T 3: 129,582,180 (GRCm39) C602* probably null Het
Lyst T C 13: 13,884,149 (GRCm39) S2986P probably benign Het
Mapkapk5 T C 5: 121,663,291 (GRCm39) T445A probably benign Het
Mms19 A T 19: 41,952,372 (GRCm39) M119K possibly damaging Het
Myo7a T C 7: 97,715,611 (GRCm39) D63G probably damaging Het
Nscme3l A T 19: 5,553,022 (GRCm39) V253D probably damaging Het
Nsun2 G A 13: 69,777,840 (GRCm39) probably null Het
Or13a24 C A 7: 140,154,302 (GRCm39) P79T probably damaging Het
Or1ak2 T G 2: 36,827,563 (GRCm39) L144R probably damaging Het
Or2ag1b T A 7: 106,288,353 (GRCm39) Y195F possibly damaging Het
Or51t4 T C 7: 102,598,005 (GRCm39) L101P possibly damaging Het
Pabpc2 T C 18: 39,907,253 (GRCm39) F173L probably damaging Het
Rngtt A G 4: 33,499,035 (GRCm39) I531V probably benign Het
Sacs A G 14: 61,442,135 (GRCm39) M1394V probably benign Het
Setd1b G T 5: 123,286,167 (GRCm39) E404D unknown Het
Slc25a54 G A 3: 109,005,984 (GRCm39) R164H probably benign Het
Slc2a13 A G 15: 91,234,223 (GRCm39) V371A possibly damaging Het
Spag9 C G 11: 93,988,079 (GRCm39) L798V possibly damaging Het
Tbce A T 13: 14,172,980 (GRCm39) S484T possibly damaging Het
Tcf12 C T 9: 71,776,345 (GRCm39) R399Q probably damaging Het
Ttn A G 2: 76,615,177 (GRCm39) V16847A probably benign Het
Ttn A G 2: 76,687,210 (GRCm39) probably benign Het
Vmn1r11 T G 6: 57,114,515 (GRCm39) L23V probably benign Het
Vmn2r59 C T 7: 41,691,874 (GRCm39) C541Y probably damaging Het
Vmn2r82 A C 10: 79,214,874 (GRCm39) T286P possibly damaging Het
Vps13c T G 9: 67,889,777 (GRCm39) probably null Het
Ypel1 A T 16: 16,921,464 (GRCm39) Y73* probably null Het
Zdhhc6 T C 19: 55,291,169 (GRCm39) I349V probably benign Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4446:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46,661,093 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46,657,673 (GRCm39) missense probably benign
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46,658,166 (GRCm39) missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGGGGCAATCTCCAGTAG -3'
(R):5'- TCTAGATGTAATCCTGGCAGAAACC -3'

Sequencing Primer
(F):5'- CAATCTCCAGTAGGATGGGAAC -3'
(R):5'- ATGATTGAGAATGGGGGAGGGTTC -3'
Posted On 2015-07-21