Incidental Mutation 'R4445:Cyp17a1'
ID329873
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Namecytochrome P450, family 17, subfamily a, polypeptide 1
Synonymssteroid 17-alpha hydroxylase, p450c17, Cyp17
MMRRC Submission 041151-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R4445 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46667165-46672974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46668023 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 411 (F411L)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: F411L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: F411L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,502,994 V253D probably damaging Het
2410089E03Rik A G 15: 8,252,188 D2837G unknown Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Adgrl1 T C 8: 83,934,860 L962P probably damaging Het
Als2cr12 A T 1: 58,666,921 I263K possibly damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Calcoco1 A G 15: 102,715,740 probably null Het
Cd59a A G 2: 104,110,818 Q47R probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cfap45 G A 1: 172,535,227 V262M probably benign Het
Chd8 A T 14: 52,204,527 probably null Het
Cntnap2 C T 6: 46,759,851 T737I probably benign Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp4a12a G A 4: 115,326,783 probably null Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Ddx56 A T 11: 6,265,770 probably null Het
Elmod1 T A 9: 53,934,129 D93V probably damaging Het
Epb41l2 T C 10: 25,443,803 L178P possibly damaging Het
Galnt10 T A 11: 57,783,691 V502D probably damaging Het
Gm11735 T C 11: 116,739,062 noncoding transcript Het
Hist1h4k T C 13: 21,750,343 T55A possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Ip6k3 A G 17: 27,145,102 I324T probably benign Het
Klkb1 C T 8: 45,277,055 S263N probably benign Het
Lrit3 A T 3: 129,788,531 C602* probably null Het
Lyst T C 13: 13,709,564 S2986P probably benign Het
Mapkapk5 T C 5: 121,525,228 T445A probably benign Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo7a T C 7: 98,066,404 D63G probably damaging Het
Nsun2 G A 13: 69,629,721 probably null Het
Olfr356 T G 2: 36,937,551 L144R probably damaging Het
Olfr538 C A 7: 140,574,389 P79T probably damaging Het
Olfr574 T C 7: 102,948,798 L101P possibly damaging Het
Olfr694 T A 7: 106,689,146 Y195F possibly damaging Het
Pabpc2 T C 18: 39,774,200 F173L probably damaging Het
Ppil2 A T 16: 17,103,600 Y73* probably null Het
Rngtt A G 4: 33,499,035 I531V probably benign Het
Sacs A G 14: 61,204,686 M1394V probably benign Het
Setd1b G T 5: 123,148,104 E404D unknown Het
Slc25a54 G A 3: 109,098,668 R164H probably benign Het
Slc2a13 A G 15: 91,350,020 V371A possibly damaging Het
Spag9 C G 11: 94,097,253 L798V possibly damaging Het
Tbce A T 13: 13,998,395 S484T possibly damaging Het
Tcf12 C T 9: 71,869,063 R399Q probably damaging Het
Ttn A G 2: 76,784,833 V16847A probably benign Het
Ttn A G 2: 76,856,866 probably benign Het
Vmn1r11 T G 6: 57,137,530 L23V probably benign Het
Vmn2r59 C T 7: 42,042,450 C541Y probably damaging Het
Vmn2r82 A C 10: 79,379,040 T286P possibly damaging Het
Vps13c T G 9: 67,982,495 probably null Het
Wdr60 G A 12: 116,207,715 A967V probably damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4446:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46669234 missense probably benign
R6729:Cyp17a1 UTSW 19 46670581 missense probably benign
R7025:Cyp17a1 UTSW 19 46670980 missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGGGGCAATCTCCAGTAG -3'
(R):5'- TCTAGATGTAATCCTGGCAGAAACC -3'

Sequencing Primer
(F):5'- CAATCTCCAGTAGGATGGGAAC -3'
(R):5'- ATGATTGAGAATGGGGGAGGGTTC -3'
Posted On2015-07-21