Incidental Mutation 'R4446:Rnf13'
ID329883
Institutional Source Beutler Lab
Gene Symbol Rnf13
Ensembl Gene ENSMUSG00000036503
Gene Namering finger protein 13
Synonyms2010001H16Rik, Rzf
MMRRC Submission 041707-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4446 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location57736062-57835233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 57820589 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 230 (K230T)
Ref Sequence ENSEMBL: ENSMUSP00000142335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041826] [ENSMUST00000197205] [ENSMUST00000198214] [ENSMUST00000199041] [ENSMUST00000200497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041826
AA Change: K230T

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049331
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 63 160 1.3e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
RING 240 281 1.85e-8 SMART
low complexity region 291 299 N/A INTRINSIC
low complexity region 336 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197205
SMART Domains Protein: ENSMUSP00000143692
Gene: ENSMUSG00000036503

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:PA 62 153 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197920
Predicted Effect probably damaging
Transcript: ENSMUST00000198214
AA Change: K230T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143498
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 63 160 5.1e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199041
AA Change: K230T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142335
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 59 162 6.6e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 2e-7 SMART
Blast:RING 240 267 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200497
AA Change: K230T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142462
Gene: ENSMUSG00000036503
AA Change: K230T

DomainStartEndE-ValueType
Pfam:PA 59 162 1.1e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 1e-7 SMART
Blast:RING 240 261 9e-8 BLAST
low complexity region 262 270 N/A INTRINSIC
low complexity region 307 328 N/A INTRINSIC
Meta Mutation Damage Score 0.1522 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: This gene encodes a member of the PA-TM-RING family of proteins that contain a protease associated (PA) domain and a RING finger domain separated by a transmembrane (TM) domain. The encoded protein is an E3 ubiquitin ligase localized to the endosomal-lysosomal vesicles and inner nuclear membrane. Mice lacking the encoded protein have impaired learning abilities associated with a decreased synaptic vesicle density and dysregulated SNARE complex assembly. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on the X chromosome. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,833,423 noncoding transcript Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Akt1 C T 12: 112,659,133 R144H probably benign Het
Arrdc3 T C 13: 80,889,063 probably benign Het
Asxl2 T A 12: 3,501,774 V1172E possibly damaging Het
Atp9a C T 2: 168,681,997 A242T possibly damaging Het
C2cd3 C T 7: 100,374,477 T90I probably damaging Het
C4bp A G 1: 130,642,955 S295P probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cep131 T C 11: 120,064,819 E1025G probably damaging Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Dgkb G T 12: 38,184,953 G439V probably damaging Het
Dgkh A G 14: 78,628,083 V20A probably damaging Het
Dysf A G 6: 84,205,872 N2035S probably damaging Het
Fam69a T C 5: 107,924,634 Y52C probably damaging Het
Fzd1 A G 5: 4,755,777 Y602H probably damaging Het
Gm3139 T A 5: 94,537,843 I454K probably damaging Het
Gm38706 C A 6: 130,483,310 noncoding transcript Het
Hmmr T C 11: 40,715,321 Q274R probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Klf5 C T 14: 99,302,230 R360C probably damaging Het
Lrat A G 3: 82,896,986 M228T probably damaging Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo3a A T 2: 22,600,137 K565N probably damaging Het
Olfr1378 C T 11: 50,969,863 P282S probably damaging Het
Olfr148 A T 9: 39,613,998 I144L probably benign Het
Olfr411 T C 11: 74,346,762 D274G probably benign Het
Pcdha6 A G 18: 36,967,760 D2G probably benign Het
Pcdhga3 A G 18: 37,675,885 R464G probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Sema6d A G 2: 124,664,059 M596V probably damaging Het
Slc25a25 T C 2: 32,430,609 K47E probably benign Het
Sptbn1 C T 11: 30,139,114 R716H possibly damaging Het
Ssx2ip G A 3: 146,426,431 V216I probably benign Het
Tatdn2 T G 6: 113,702,540 probably null Het
Tmprss6 A G 15: 78,452,839 Y356H probably damaging Het
Ttn A G 2: 76,856,866 probably benign Het
Umod A G 7: 119,466,056 probably null Het
Vmn2r93 T A 17: 18,304,050 I102K possibly damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Rnf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Rnf13 APN 3 57807087 missense probably benign 0.06
IGL01835:Rnf13 APN 3 57820586 missense probably damaging 1.00
IGL02219:Rnf13 APN 3 57796223 missense probably damaging 1.00
IGL02675:Rnf13 APN 3 57779396 missense probably benign 0.17
IGL03015:Rnf13 APN 3 57833744 missense possibly damaging 0.74
IGL03246:Rnf13 APN 3 57769050 missense probably damaging 0.98
R0147:Rnf13 UTSW 3 57802468 missense probably damaging 0.98
R0481:Rnf13 UTSW 3 57779451 missense probably damaging 1.00
R0481:Rnf13 UTSW 3 57807053 missense probably damaging 1.00
R1389:Rnf13 UTSW 3 57779496 missense probably damaging 1.00
R2146:Rnf13 UTSW 3 57802486 missense probably null 0.99
R3964:Rnf13 UTSW 3 57769112 missense probably damaging 0.96
R4444:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4489:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4810:Rnf13 UTSW 3 57796272 missense probably damaging 0.99
R4940:Rnf13 UTSW 3 57796206 missense probably damaging 0.98
R6233:Rnf13 UTSW 3 57832970 missense possibly damaging 0.83
R7002:Rnf13 UTSW 3 57833612 missense probably damaging 0.96
R7622:Rnf13 UTSW 3 57820534 nonsense probably null
R7652:Rnf13 UTSW 3 57764351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGGTTTTACAGCATCTATCCAG -3'
(R):5'- GTGGCAATGTATATTTCTCCCCG -3'

Sequencing Primer
(F):5'- CTTTCCATCTTTAGATCACAAA -3'
(R):5'- CCTTTACCAGGCTACCAGTAC -3'
Posted On2015-07-21